HUGE

Gene/Protein Characteristic Table for KIAA2019

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04069
Accession No. :	AB095939
Description :	AHNAK2 protein.
HUGO Gene Name :
Clone Name :	ha06118 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 9217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 809 bp

Genome contig ID gi51511730r_104374636
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TCCCTGGATGGGCAATAAAGAAAGTGCTGCATCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGCTGAAGGCTGCTGAGGTCTTCTGTCTCAGGGTCGAAGTTTACCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 104474636 104483853 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 2797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVF2	99.9	Protein AHNAK2.	Homo sapiens
XP_001144198	92.2	AHNAK nucleopro...	Pan troglodytes
CAD98019	99.5	hypothetical pr...	Homo sapiens
CAD97904	99.6	hypothetical pr...	Homo sapiens
CAD97981	99.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046840	4.5e-05	25.5	KIAA1620

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGGACCAAAACTGAGCACG

Primer_r
: AGCAAGCCCCAAGTTACCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	809 bp
Genome contig ID	gi51511730r_104374636
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCCTGGATGGGCAATAAAGAAAGTGCTGCATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCTGAAGGCTGCTGAGGTCTTCTGTCTCAGGGTCGAAGTTTACCAGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	104474636	104483853	1	99.0	Perfect prediction

Primer_f	: CAAGGACCAAAACTGAGCACG
Primer_r	: AGCAAGCCCCAAGTTACCATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2019

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information