HUGE

Gene/Protein Characteristic Table for KIAA0754

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05620
Accession No. :	AB018297
Description :
HUGO Gene Name :
Clone Name :	hh06485 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk04470, former representative clones for KIAA0754 with hh06485. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5460 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1933 bp

Genome contig ID gi89161185f_39549282
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCTAGGCAACATAGTAAGACCCCATCTCTGAG
Flanking genome sequence
(105461 - 105510)
----+----*----+----*----+----*----+----*----+----*
AAAATAAAAAGAAAAAAAAAAAAACAGAATATCTCCAGTATAAAGCTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 39649282 39654741 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_055853	0	100.0	hypothetical pr...	Homo sapiens
XP_001170899	0	93.2	hypothetical pr...	Pan troglodytes
BAC87042	1.7e-207	98.7	unnamed protein...	Homo sapiens
AAW51128	7.8e-24	31.2	minus agglutini...	Chlamydomonas i...
AAX33674	2.5e-22	32.1	plus agglutinin...	Chlamydomonas i...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	0.00023	22.2	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATAATCTGGCCTTGCTGAGTG

Primer_r
: TACAGGCTATTGGGATCTCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATAATCTGGCCTTGCTGAGTG
Primer_r	: TACAGGCTATTGGGATCTCGG
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1933 bp
Genome contig ID	gi89161185f_39549282
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTAGGCAACATAGTAAGACCCCATCTCTGAG
Flanking genome sequence (105461 - 105510)	----+--------+--------+--------+--------+----* AAAATAAAAAGAAAAAAAAAAAAACAGAATATCTCCAGTATAAAGCTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	39649282	39654741	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0754

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information