ROUGE

Gene/Protein Characteristic Table for mKIAA1620

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173220
Description :	Periaxin.
Clone Name :	mfj44318 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4465 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 207 bp

Genome contig ID gi65511124f_22783843
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGTCAAACTATGGGAATAAAATAATTCAAAAGTT
Flanking genome sequence
(112460 - 112509)
----+----*----+----*----+----*----+----*----+----*
GTCATGTGTCTTGGTTCTCGTGGGGGACACAAGGTCTCTTTATGTTTCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1620 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1620	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4258
Length: 1418 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH68135	99.8	Prx protein [Mu...	Mus musculus
EDL24182	99.7	periaxin, isofo...	Mus musculus
NP_932165	99.6	periaxin isofor...	Mus musculus
O55103	99.7	Periaxin.	Mus musculus
Q63425	91.7	Periaxin.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173178	0.001	24.4	mKIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 45 124 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 55 127 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 43 112 PS50106 PDZ/DHR/GLGF

IPR000694 460 727 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	45	124	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	55	127	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	43	112	PS50106	PDZ/DHR/GLGF
IPR000694	460	727	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	207 bp
Genome contig ID	gi65511124f_22783843
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGTCAAACTATGGGAATAAAATAATTCAAAAGTT
Flanking genome sequence (112460 - 112509)	----+--------+--------+--------+--------+----* GTCATGTGTCTTGGTTCTCGTGGGGGACACAAGGTCTCTTTATGTTTCCT

Gene/Protein Characteristic Table for mKIAA1620

Features of the cloned DNA sequence

Features of the protein sequence