HUGE

Gene/Protein Characteristic Table for KIAA0357

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04800
Accession No. :	AB002355
Description :	Ciliary dynein heavy chain 9.
HUGO Gene Name :	dynein, axonemal, heavy chain 9 (DNAH9)
Clone Name :	hh00016y2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh00016, former representative clones for KIAA0357 with hh00016y2. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 9198 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 219 bp

Genome contig ID gi51511734f_11434119
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GGGCCCAGGTTTCTTAATAAAATGATTTACTCTTC
Flanking genome sequence
(379671 - 379720)
----+----*----+----*----+----*----+----*----+----*
AACTGTGTCTGGCCCAGGATTTGAGAGCTGCTGAATCATAAATGATCATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 11534119 11813788 49 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2992 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06712	100.0	DNAH9 variant p...	Homo sapiens
AAI53884	100.0	DNAH9 protein [...	Homo sapiens
EAW89980	99.9	dynein, axonema...	Homo sapiens
NP_001363	97.5	dynein, axonema...	Homo sapiens
Q9NYC9	97.5	Dynein heavy ch...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	0	37.2	KIAA1503
AB051484	9.9e-160	32.4	KIAA1697
AB095937	1.5e-135	37.8	KIAA2017
AB046823	1.2e-101	32.9	KIAA1603
AB023161	6.4e-91	34.8	KIAA0944

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013602 1 285 PF08393 Dynein heavy chain

IPR011704 728 872 PF07728 ATPase associated with various cellular activities

IPR004273 2364 2991 PF03028 Dynein heavy chain

HMMSmart IPR003593 447 583 SM00382 AAA+ ATPase

IPR003593 725 857 SM00382 AAA+ ATPase

IPR003593 1052 1203 SM00382 AAA+ ATPase

IPR003593 1399 1502 SM00382 AAA+ ATPase

ScanRegExp IPR005479 2599 2606 PS00867 Carbamoyl-phosphate synthase L chain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1	285	PF08393	Dynein heavy chain
IPR011704	728	872	PF07728	ATPase associated with various cellular activities
IPR004273	2364	2991	PF03028	Dynein heavy chain
HMMSmart	IPR003593	447	583	SM00382	AAA+ ATPase
IPR003593	725	857	SM00382	AAA+ ATPase
IPR003593	1052	1203	SM00382	AAA+ ATPase
IPR003593	1399	1502	SM00382	AAA+ ATPase
ScanRegExp	IPR005479	2599	2606	PS00867	Carbamoyl-phosphate synthase L chain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1955 ERTLCGDILLITAFISYLGFFT 1976 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1955	ERTLCGDILLITAFISYLGFFT	1976	PRIMARY	22

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCACATTCCTTCAGCTCAGCC

Primer_r
: CACCACAGACACTTAGAACGG

PCR conditions
: 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACATTCCTTCAGCTCAGCC
Primer_r	: CACCACAGACACTTAGAACGG
PCR product length	: 112 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	219 bp
Genome contig ID	gi51511734f_11434119
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGGCCCAGGTTTCTTAATAAAATGATTTACTCTTC
Flanking genome sequence (379671 - 379720)	----+--------+--------+--------+--------+----* AACTGTGTCTGGCCCAGGATTTGAGAGCTGCTGAATCATAAATGATCATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	11534119	11813788	49	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0357

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information