HUGE

Gene/Protein Characteristic Table for KIAA1594

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07316
Accession No. :	AB046814
Description :	Ubiquitin carboxyl-terminal hydrolase 37.
HUGO Gene Name :	ubiquitin specific peptidase 37 (USP37)
Clone Name :	fj09468 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1652 bp

Genome contig ID gi89161199r_218926341
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCAGTCTGAGTGACAGAGTGAGACTCCATCTCATT
Flanking genome sequence
(99904 - 99855)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAACGAAAACAAAAACAAAAAAAACACAAACCATCATCACAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 219026245 219126695 22 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70621	100.0	ubiquitin speci...	Homo sapiens
CAL38294	99.9	hypothetical pr...	synthetic construct
AAI44250	99.9	USP37 protein [...	Homo sapiens
XP_516090	99.8	hypothetical pr...	Pan troglodytes
CAL37807	99.7	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020698	1.9e-05	25.4	KIAA0891
AB011101	5.1e-05	21.5	KIAA0529

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 290 900 PF00443 Peptidase C19

IPR003903 655 672 PF02809 Ubiquitin interacting motif

IPR003903 757 774 PF02809 Ubiquitin interacting motif

IPR003903 779 796 PF02809 Ubiquitin interacting motif

HMMSmart IPR003903 603 622 SM00726 Ubiquitin interacting motif

IPR003903 656 675 SM00726 Ubiquitin interacting motif

IPR003903 758 777 SM00726 Ubiquitin interacting motif

IPR003903 780 799 SM00726 Ubiquitin interacting motif

ProfileScan IPR001394 293 904 PS50235 Peptidase C19

IPR003903 656 675 PS50330 Ubiquitin interacting motif

IPR003903 758 777 PS50330 Ubiquitin interacting motif

IPR003903 780 799 PS50330 Ubiquitin interacting motif

ScanRegExp IPR001394 294 309 PS00972 Peptidase C19

IPR001394 841 859 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	290	900	PF00443	Peptidase C19
IPR003903	655	672	PF02809	Ubiquitin interacting motif
IPR003903	757	774	PF02809	Ubiquitin interacting motif
IPR003903	779	796	PF02809	Ubiquitin interacting motif
HMMSmart	IPR003903	603	622	SM00726	Ubiquitin interacting motif
IPR003903	656	675	SM00726	Ubiquitin interacting motif
IPR003903	758	777	SM00726	Ubiquitin interacting motif
IPR003903	780	799	SM00726	Ubiquitin interacting motif
ProfileScan	IPR001394	293	904	PS50235	Peptidase C19
IPR003903	656	675	PS50330	Ubiquitin interacting motif
IPR003903	758	777	PS50330	Ubiquitin interacting motif
IPR003903	780	799	PS50330	Ubiquitin interacting motif
ScanRegExp	IPR001394	294	309	PS00972	Peptidase C19
IPR001394	841	859	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGGTTCTGATGAGGACTCTG

Primer_r
: GACCTGAAGAAGAAGTGCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: TGGGTTCTGATGAGGACTCTG
Primer_r	: GACCTGAAGAAGAAGTGCTAC
PCR product length	: 162(2k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1652 bp
Genome contig ID	gi89161199r_218926341
PolyA signal sequence (None)	+--------+--------+----*----+---- GCAGTCTGAGTGACAGAGTGAGACTCCATCTCATT
Flanking genome sequence (99904 - 99855)	----+--------+--------+--------+--------+----* AAAAAAAACGAAAACAAAAACAAAAAAAACACAAACCATCATCACAGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	219026245	219126695	22	99.6	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1594

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information