| HUGE |
Gene/Protein Characteristic Table for KIAA0529 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00553 |
|---|---|
| Accession No. : | AB011101 |
| Description : | Ubiquitin carboxyl-terminal hydrolase 15. |
| HUGO Gene Name : | ubiquitin specific peptidase 15 (USP15) |
| Clone Name : | hg02898s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0529
![]() |
| Source : | Human adult brain |
| Note : | We replaced hg02898, former representative clones for KIAA0529 with hg02898s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4602 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1743 bp Genome contig ID gi89161190f_60840463 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TTTATATAGATTTCAATAAAGCTATTCAAGGCCTTFlanking genome sequence
(245704 - 245753) ----+----*----+----*----+----*----+----*----+----*
ATTTAGTCTTTTATTTCTTACTCTTAATCTTTTAATAAAAATCCCCTACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 60940463 61086165 21 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 952 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TTCTTTGTGTGTTCCTGATGG | |
| : CCTGGATCCTTGAATGTGGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 12 |
| : GeneBridge 4 | |
| : TTCTTTGTGTGTTCCTGATGG | |
| : CCTGGATCCTTGAATGTGGTG | |
| : 168 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |