| HUGE | 
Gene/Protein Characteristic Table for KIAA0891 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01614 | 
|---|---|
| Accession No. : | AB020698 | 
| Description : | Ubiquitin carboxyl-terminal hydrolase 19 (Fragment). | 
| HUGO Gene Name : | ubiquitin specific peptidase 19 (USP19) | 
| Clone Name : | hk08201 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA0891
                   ![]()  | 
| Source : | Human adult brain | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4401 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | YES | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 283 bp Genome contig ID gi89161205r_49021112 PolyA signal sequence 
(AATAAA,-24) +----*----+----*----+----*----+----
TTAAAAGTGTTAATAAAACCAGACTATTCAGGCCCFlanking genome sequence 
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATCTCGTCTCTCTGTCTCAACGCCGCTGCTGTCTGCGCCTGCCTTGGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 49121112 49133217 26 99.9 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 1371 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
    Expression profile | 
Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : CATGCCTGCCTTTGTTGTGGG | |
| : AGAGCAGCAGGATGAATGGAC | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 3 | 
| : GeneBridge 4 | |
| : GCCATGCCTGCCTTTGTTGTG | |
| : CAGACAGCCAGATGGATACAC | |
| : 135 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |