HUGE

Gene/Protein Characteristic Table for KIAA1590

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00251
Accession No. :	AB046810
Description :	Kinesin-like motor protein C20orf23.
HUGO Gene Name :
Clone Name :	fj09048y1 [Vector Info]
Flexi ORF Clone :	pF1KA1590
Source :	Human fetal brain
Note :	We replaced fj09048, former representative clones for KIAA1590 with fj09048y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 4558 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 303 bp

Genome contig ID gi51511747r_16195488
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TTATTTGTGAGGTGATTAAAGCATTTCTGATTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTTTTCGTGTCGATTTATAGTGTGGTGGCTTGGAATCTGTCTGTGCCTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 16295488 16501996 23 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50262	100.0	KIF16B protein ...	Homo sapiens
CAI22745	99.9	chromosome 20 o...	Homo sapiens
XP_001086005	97.6	similar to kine...	Macaca mulatta
EAX10289	99.7	chromosome 20 o...	Homo sapiens
Q96L93	99.9	Kinesin-like pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26361	7.2e-35	40.9	KIAA0042
AB014539	7.5e-31	39.5	KIAA0639
AB011163	9.5e-30	39.5	KIAA0591
AB040881	1.6e-27	35.7	KIAA1448
AB014606	1.4e-26	42.5	KIAA0706

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 94 115 PR00380 Kinesin

IPR001752 215 232 PR00380 Kinesin

IPR001752 248 266 PR00380 Kinesin

IPR001752 309 330 PR00380 Kinesin

HMMPfam IPR001752 10 360 PF00225 Kinesin

IPR000253 479 545 PF00498 Forkhead-associated

HMMSmart IPR001752 2 367 SM00129 Kinesin

ProfileScan IPR001752 1 278 PS50067 Kinesin

ScanRegExp IPR001752 247 258 PS00411 Kinesin

IPR001220 446 452 PS00307 Legume lectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	94	115	PR00380	Kinesin
IPR001752	215	232	PR00380	Kinesin
IPR001752	248	266	PR00380	Kinesin
IPR001752	309	330	PR00380	Kinesin
HMMPfam	IPR001752	10	360	PF00225	Kinesin
IPR000253	479	545	PF00498	Forkhead-associated
HMMSmart	IPR001752	2	367	SM00129	Kinesin
ProfileScan	IPR001752	1	278	PS50067	Kinesin
ScanRegExp	IPR001752	247	258	PS00411	Kinesin
IPR001220	446	452	PS00307	Legume lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCAAATGGAGTTCAGGTGTC

Primer_r
: GTGTTCAGAAGGACTAGCGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	303 bp
Genome contig ID	gi51511747r_16195488
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTATTTGTGAGGTGATTAAAGCATTTCTGATTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTTCGTGTCGATTTATAGTGTGGTGGCTTGGAATCTGTCTGTGCCTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	16295488	16501996	23	99.4	Perfect prediction

Primer_f	: GCCAAATGGAGTTCAGGTGTC
Primer_r	: GTGTTCAGAAGGACTAGCGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1590

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information