ROUGE

Gene/Protein Characteristic Table for mKIAA1590

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129401
Description :	KIF16B (Fragment).
Clone Name :	mph00219 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3290 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2043 bp

Genome contig ID gi66880554r_142032562
PolyA signal sequence
(ATTAAA,-28)
+----*----+----*----+----*----+----
CAAATTTATTAAAGGTGTTTGCTTTTTCAACTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGAGCTGCTATCAATATTAAATGAAGTCATGTGCTATACCCTGTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1590 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1590	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1238, 1247..1780
Length: 590 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL28422	3.6e-118	87.0	mCG129350, isof...	Mus musculus
EDL28421	3.7e-118	87.0	mCG129350, isof...	Mus musculus
CAM13299	3.8e-118	87.0	kinesin family ...	Mus musculus
BAC28130	5.7e-118	90.0	unnamed protein...	Mus musculus
EDL95193	1.2e-107	78.4	kinesin family ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 111 312 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	111	312	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2043 bp
Genome contig ID	gi66880554r_142032562
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- CAAATTTATTAAAGGTGTTTGCTTTTTCAACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTGAGCTGCTATCAATATTAAATGAAGTCATGTGCTATACCCTGTAG

Gene/Protein Characteristic Table for mKIAA1590

Features of the cloned DNA sequence

Features of the protein sequence