HUGE

Gene/Protein Characteristic Table for KIAA0591

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01098
Accession No. :	AB011163
Description :	Kinesin-like protein KIF1B.
HUGO Gene Name :	kinesin family member 1B (KIF1B)
Clone Name :	hj02790y1 [Vector Info]
Flexi ORF Clone :	pF1KA0591
Source :	Human adult brain
Note :	We replaced hj02790, former representative clones for KIAA0591 with hj02790y1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7002 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1350 bp

Genome contig ID gi89161185f_10094261
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCCAGCCTGGGTGACAGAGCAAGACTCTGCCTCAG
Flanking genome sequence
(266323 - 266372)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATAATAATGCTGGGTAGTGACCTTGTGATTGTTACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 10194261 10360582 48 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1849 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10360	100.0	kinesin family ...	synthetic construct
O60333	99.9	Kinesin-like pr...	Homo sapiens
CAI95754	99.9	kinesin family ...	Homo sapiens
Q60575	97.0	Kinesin-like pr...	Mus musculus
AAD39438	96.8	kif1b major iso...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040881	9.9e-104	92.4	KIAA1448
AB014606	1.7e-84	71.4	KIAA0706
AB014539	3.2e-57	40.6	KIAA0639
AB046810	7e-56	39.5	KIAA1590
D26361	6.7e-46	34.4	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 121 142 PR00380 Kinesin

IPR001752 241 258 PR00380 Kinesin

IPR001752 276 294 PR00380 Kinesin

IPR001752 337 358 PR00380 Kinesin

HMMPfam IPR001752 44 388 PF00225 Kinesin

IPR000253 589 660 PF00498 Forkhead-associated

IPR001849 1735 1832 PF00169 Pleckstrin-like

HMMSmart IPR001752 36 395 SM00129 Kinesin

IPR000253 588 645 SM00240 Forkhead-associated

IPR001849 1735 1834 SM00233 Pleckstrin-like

ProfileScan IPR001752 35 306 PS50067 Kinesin

IPR000253 589 645 PS50006 Forkhead-associated

IPR001849 1734 1832 PS50003 Pleckstrin-like

ScanRegExp IPR001752 275 286 PS00411 Kinesin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	121	142	PR00380	Kinesin
IPR001752	241	258	PR00380	Kinesin
IPR001752	276	294	PR00380	Kinesin
IPR001752	337	358	PR00380	Kinesin
HMMPfam	IPR001752	44	388	PF00225	Kinesin
IPR000253	589	660	PF00498	Forkhead-associated
IPR001849	1735	1832	PF00169	Pleckstrin-like
HMMSmart	IPR001752	36	395	SM00129	Kinesin
IPR000253	588	645	SM00240	Forkhead-associated
IPR001849	1735	1834	SM00233	Pleckstrin-like
ProfileScan	IPR001752	35	306	PS50067	Kinesin
IPR000253	589	645	PS50006	Forkhead-associated
IPR001849	1734	1832	PS50003	Pleckstrin-like
ScanRegExp	IPR001752	275	286	PS00411	Kinesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAAGGGAAATGCCAAGGATGC

Primer_r
: TCCAACTGTACCACCACCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAAGGGAAATGCCAAGGATGC
Primer_r	: TCCAACTGTACCACCACCATC
PCR product length	: 207 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1350 bp
Genome contig ID	gi89161185f_10094261
PolyA signal sequence (None)	+--------+--------+----*----+---- TCCAGCCTGGGTGACAGAGCAAGACTCTGCCTCAG
Flanking genome sequence (266323 - 266372)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATAATAATGCTGGGTAGTGACCTTGTGATTGTTACAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	10194261	10360582	48	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0591

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information