HUGE |
Gene/Protein Characteristic Table for KIAA0591 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01098 |
---|---|
Accession No. : | AB011163 |
Description : | Kinesin-like protein KIF1B. |
HUGO Gene Name : | kinesin family member 1B (KIF1B) |
Clone Name : | hj02790y1 [Vector Info] |
Flexi ORF Clone : | pF1KA0591
![]() |
Source : | Human adult brain |
Note : | We replaced hj02790, former representative clones for KIAA0591 with hj02790y1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7002 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1350 bp Genome contig ID gi89161185f_10094261 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCAGCCTGGGTGACAGAGCAAGACTCTGCCTCAGFlanking genome sequence
(266323 - 266372) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATAATAATGCTGGGTAGTGACCTTGTGATTGTTACAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 10194261 10360582 48 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1849 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 121 | 142 | PR00380 | Kinesin |
IPR001752 | 241 | 258 | PR00380 | Kinesin | |
IPR001752 | 276 | 294 | PR00380 | Kinesin | |
IPR001752 | 337 | 358 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 44 | 388 | PF00225 | Kinesin |
IPR000253 | 589 | 660 | PF00498 | Forkhead-associated | |
IPR001849 | 1735 | 1832 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001752 | 36 | 395 | SM00129 | Kinesin |
IPR000253 | 588 | 645 | SM00240 | Forkhead-associated | |
IPR001849 | 1735 | 1834 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001752 | 35 | 306 | PS50067 | Kinesin |
IPR000253 | 589 | 645 | PS50006 | Forkhead-associated | |
IPR001849 | 1734 | 1832 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR001752 | 275 | 286 | PS00411 | Kinesin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GAAGGGAAATGCCAAGGATGC | |
: TCCAACTGTACCACCACCATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GAAGGGAAATGCCAAGGATGC | |
: TCCAACTGTACCACCACCATC | |
: 207 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |