HUGE

Gene/Protein Characteristic Table for KIAA1564

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04551
Accession No. :	AB046784
Description :	Chromodomain-helicase-DNA-binding protein 8.
HUGO Gene Name :	chromodomain helicase DNA binding protein 8 (CHD8)
Clone Name :	fh20840s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh20840 and ha02583, former representative clones for KIAA1564 with fh20840s1. (2002/5/10,2003/8/28)

Features of the cloned DNA sequence	Description

Length: 7426 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 127 bp

Genome contig ID gi51511730r_20823485
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGTGGGGAAGTCCAGGACTCCAGGAGGTGAAAAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATGTACCTGATTGCTCCCAATTATGAGAGGATTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 20923485 20969195 37 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2432 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001153522	100.0	chromodomain he...	Pan troglodytes
XP_001096619	99.6	similar to chro...	Macaca mulatta
EDL88472	96.5	chromodomain he...	Rattus norvegicus
EDL42251	96.4	mCG18716, isofo...	Mus musculus
ABB02259	96.3	chromodomain he...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037837	4e-166	59.2	KIAA1416
AB002306	1.6e-159	52.8	KIAA0308
AB037756	1.6e-117	65.4	KIAA1335
AB007913	4.8e-16	48.2	KIAA0444
AB002307	2.7e-10	27.5	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000257 950 1093 PD003225 Uroporphyrinogen decarboxylase (URO-D)

HMMPfam IPR000953 493 555 PF00385 Chromo

IPR000953 575 629 PF00385 Chromo

IPR000330 665 952 PF00176 SNF2-related

IPR001650 1019 1098 PF00271 DNA/RNA helicase

IPR006576 2161 2205 PF07533 BRK

IPR006576 2230 2266 PF07533 BRK

HMMSmart IPR000953 491 557 SM00298 Chromo

IPR000953 573 631 SM00298 Chromo

IPR014001 658 860 SM00487 DEAD-like helicases

IPR001650 1014 1098 SM00490 DNA/RNA helicase

IPR006576 2161 2205 SM00592 BRK

IPR006576 2230 2270 SM00592 BRK

ProfileScan IPR000953 575 641 PS50013 Chromo

IPR014021 674 848 PS51192 Helicase

IPR001650 988 1139 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000257	950	1093	PD003225	Uroporphyrinogen decarboxylase (URO-D)
HMMPfam	IPR000953	493	555	PF00385	Chromo
IPR000953	575	629	PF00385	Chromo
IPR000330	665	952	PF00176	SNF2-related
IPR001650	1019	1098	PF00271	DNA/RNA helicase
IPR006576	2161	2205	PF07533	BRK
IPR006576	2230	2266	PF07533	BRK
HMMSmart	IPR000953	491	557	SM00298	Chromo
IPR000953	573	631	SM00298	Chromo
IPR014001	658	860	SM00487	DEAD-like helicases
IPR001650	1014	1098	SM00490	DNA/RNA helicase
IPR006576	2161	2205	SM00592	BRK
IPR006576	2230	2270	SM00592	BRK
ProfileScan	IPR000953	575	641	PS50013	Chromo
IPR014021	674	848	PS51192	Helicase
IPR001650	988	1139	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGTTTGGTGTGGAATATGAC

Primer_r
: GGGCTCAATGAACAGGTTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	127 bp
Genome contig ID	gi51511730r_20823485
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGGGGAAGTCCAGGACTCCAGGAGGTGAAAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGTACCTGATTGCTCCCAATTATGAGAGGATTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	20923485	20969195	37	99.9	Perfect prediction

Primer_f	: ACGTTTGGTGTGGAATATGAC
Primer_r	: GGGCTCAATGAACAGGTTAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1564

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information