HUGE

Gene/Protein Characteristic Table for KIAA0444

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04547
Accession No. :	AB007913
Description :	Chromodomain helicase-DNA-binding protein 5.
HUGO Gene Name :
Clone Name :	hg00035 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 978 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAB55959	100.0	hypothetical pr...	Homo sapiens
Q8TDI0	99.9	Chromodomain-he...	Homo sapiens
XP_525165	99.8	chromodomain he...	Pan troglodytes
XP_609360	96.9	similar to chro...	Bos taurus
XP_001492263	96.6	chromodomain he...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046784	3.1e-21	48.2	KIAA1564
AB002306	5.6e-21	47.3	KIAA0308
AB037837	6.2e-21	34.0	KIAA1416
AB037756	1.3e-20	30.4	KIAA1335
AB002307	1.6e-15	33.6	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 5 23 PF00176 SNF2-related

IPR001650 83 162 PF00271 DNA/RNA helicase

IPR009463 319 383 PF06465 Protein of unknown function DUF1087

IPR009462 396 555 PF06461 Protein of unknown function DUF1086

IPR012957 754 927 PF08074 CHD

HMMSmart IPR001650 78 162 SM00490 DNA/RNA helicase

ProfileScan IPR001650 52 217 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	5	23	PF00176	SNF2-related
IPR001650	83	162	PF00271	DNA/RNA helicase
IPR009463	319	383	PF06465	Protein of unknown function DUF1087
IPR009462	396	555	PF06461	Protein of unknown function DUF1086
IPR012957	754	927	PF08074	CHD
HMMSmart	IPR001650	78	162	SM00490	DNA/RNA helicase
ProfileScan	IPR001650	52	217	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTAAAGGTGATTGTGTTGGC
Primer_r	: TGTGTGTGTGTCCTGAACTCC
PCR product length	: 352 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0444

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information