HUGE

Gene/Protein Characteristic Table for KIAA0308

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04552
Accession No. :	AB002306
Description :	Chromodomain-helicase-DNA-binding protein 9.
HUGO Gene Name :	chromodomain helicase DNA binding protein 9 (CHD9)
Clone Name :	ee00163 [Vector Info]
Source :
Note :	We replaced hg00088 and hg00088s1, former representative clones for KIAA0308 with ee00163. (2003/8/28,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 10256 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1975 bp

Genome contig ID gi51511732f_51647871
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACCCACATGATCTTTATTCCTTCCTTTCGCCAATT
Flanking genome sequence
(270414 - 270463)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGGAAAAAAAATCTGTAGATCTTGTCACTAAAATCTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 51747871 51918283 38 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABD24032	99.9	PRIC320 isoform...	Homo sapiens
NP_079410	99.9	chromodomain he...	Homo sapiens
XP_001165654	99.8	chromodomain he...	Pan troglodytes
XP_510966	99.7	chromodomain he...	Pan troglodytes
AAT66509	99.4	KISH2; hKISH2; ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037837	2.5e-174	60.3	KIAA1416
AB046784	4.6e-168	52.8	KIAA1564
AB037756	2.7e-97	43.6	KIAA1335
AB007913	7e-17	47.3	KIAA0444
AB033085	7.1e-11	24.5	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000953 567 629 PF00385 Chromo

IPR000953 650 704 PF00385 Chromo

IPR000330 740 1027 PF00176 SNF2-related

IPR001650 1094 1173 PF00271 DNA/RNA helicase

IPR006576 2344 2393 PF07533 BRK

IPR006576 2418 2462 PF07533 BRK

HMMSmart IPR000953 565 631 SM00298 Chromo

IPR000953 648 706 SM00298 Chromo

IPR014001 733 934 SM00487 DEAD-like helicases

IPR001650 1089 1173 SM00490 DNA/RNA helicase

IPR006576 2344 2393 SM00592 BRK

IPR006576 2418 2462 SM00592 BRK

ProfileScan IPR000953 567 630 PS50013 Chromo

IPR000953 650 716 PS50013 Chromo

IPR014021 749 923 PS51192 Helicase

IPR001650 1063 1214 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000953	567	629	PF00385	Chromo
IPR000953	650	704	PF00385	Chromo
IPR000330	740	1027	PF00176	SNF2-related
IPR001650	1094	1173	PF00271	DNA/RNA helicase
IPR006576	2344	2393	PF07533	BRK
IPR006576	2418	2462	PF07533	BRK
HMMSmart	IPR000953	565	631	SM00298	Chromo
IPR000953	648	706	SM00298	Chromo
IPR014001	733	934	SM00487	DEAD-like helicases
IPR001650	1089	1173	SM00490	DNA/RNA helicase
IPR006576	2344	2393	SM00592	BRK
IPR006576	2418	2462	SM00592	BRK
ProfileScan	IPR000953	567	630	PS50013	Chromo
IPR000953	650	716	PS50013	Chromo
IPR014021	749	923	PS51192	Helicase
IPR001650	1063	1214	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 775 FLYEILLTGIRGPFLIIAPLSTI 797 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	775	FLYEILLTGIRGPFLIIAPLSTI	797	PRIMARY	23

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GACTACACAAAACACAACTGG

Primer_r
: GAAAAGTTGTCCAGCTATCAG

PCR conditions
: 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GACTACACAAAACACAACTGG
Primer_r	: GAAAAGTTGTCCAGCTATCAG
PCR product length	: 268 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1975 bp
Genome contig ID	gi51511732f_51647871
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCCACATGATCTTTATTCCTTCCTTTCGCCAATT
Flanking genome sequence (270414 - 270463)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGAAAAAAAATCTGTAGATCTTGTCACTAAAATCTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	51747871	51918283	38	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0308

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information