HUGE

Gene/Protein Characteristic Table for KIAA0343

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01070
Accession No. :	AB002341
Description :	Neuronal cell adhesion molecule precursor.
HUGO Gene Name :	neuronal cell adhesion molecule (NRCAM)
Clone Name :	hg01457 [Vector Info]
Flexi ORF Clone :	pF1KA0343
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6218 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2261 bp

Genome contig ID gi89161213r_107475330
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCAAAAAAGTAACTATTAAACAGTCTTGATCTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTGACTTTTAACTTTTTCAAACATATATTGCCTAATGTTTTAAAATGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 107575330 107827273 26 99.2 Both No-hit

Features of the protein sequence	Description

Length: 1187 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11167	100.0	neuronal cell a...	synthetic construct
AAI14571	99.9	NRCAM protein [...	Homo sapiens
AAV74326	99.7	neuronal cell a...	Pan troglodytes
EAW83427	98.8	neuronal cell a...	Homo sapiens
AAV74281	97.5	neuronal cell a...	Saimiri boliviensis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018299	8.6e-65	51.2	KIAA0756
AB040929	8.5e-55	29.9	KIAA1496
D86983	1.8e-15	33.2	KIAA0230
AB046788	1.1e-14	25.7	KIAA1568
AB018349	2e-12	28.9	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013098 53 147 PF07679 Immunoglobulin I-set

IPR013151 167 227 PF00047 Immunoglobulin

IPR013098 256 345 PF07679 Immunoglobulin I-set

IPR013098 349 437 PF07679 Immunoglobulin I-set

IPR013098 442 530 PF07679 Immunoglobulin I-set

IPR013098 536 621 PF07679 Immunoglobulin I-set

IPR003961 635 721 PF00041 Fibronectin

IPR003961 734 822 PF00041 Fibronectin

IPR003961 833 928 PF00041 Fibronectin

IPR003961 940 1029 PF00041 Fibronectin

HMMSmart IPR003599 60 149 SM00409 Immunoglobulin subtype

IPR003598 66 137 SM00408 Immunoglobulin subtype 2

IPR003599 159 246 SM00409 Immunoglobulin subtype

IPR003598 165 232 SM00408 Immunoglobulin subtype 2

IPR003599 265 346 SM00409 Immunoglobulin subtype

IPR003598 271 335 SM00408 Immunoglobulin subtype 2

IPR003599 355 438 SM00409 Immunoglobulin subtype

IPR003598 361 427 SM00408 Immunoglobulin subtype 2

IPR003599 449 531 SM00409 Immunoglobulin subtype

IPR003598 455 520 SM00408 Immunoglobulin subtype 2

IPR003599 540 622 SM00409 Immunoglobulin subtype

IPR003598 546 611 SM00408 Immunoglobulin subtype 2

IPR003961 635 718 SM00060 Fibronectin

IPR003961 735 818 SM00060 Fibronectin

IPR003961 834 925 SM00060 Fibronectin

IPR003961 940 1025 SM00060 Fibronectin

ProfileScan IPR007110 53 141 PS50835 Immunoglobulin-like

IPR007110 148 242 PS50835 Immunoglobulin-like

IPR007110 255 344 PS50835 Immunoglobulin-like

IPR007110 349 436 PS50835 Immunoglobulin-like

IPR007110 442 529 PS50835 Immunoglobulin-like

IPR007110 534 620 PS50835 Immunoglobulin-like

IPR003961 635 727 PS50853 Fibronectin

IPR003961 734 828 PS50853 Fibronectin

IPR003961 833 935 PS50853 Fibronectin

IPR003961 940 1034 PS50853 Fibronectin

ScanRegExp IPR003006 553 559 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	53	147	PF07679	Immunoglobulin I-set
IPR013151	167	227	PF00047	Immunoglobulin
IPR013098	256	345	PF07679	Immunoglobulin I-set
IPR013098	349	437	PF07679	Immunoglobulin I-set
IPR013098	442	530	PF07679	Immunoglobulin I-set
IPR013098	536	621	PF07679	Immunoglobulin I-set
IPR003961	635	721	PF00041	Fibronectin
IPR003961	734	822	PF00041	Fibronectin
IPR003961	833	928	PF00041	Fibronectin
IPR003961	940	1029	PF00041	Fibronectin
HMMSmart	IPR003599	60	149	SM00409	Immunoglobulin subtype
IPR003598	66	137	SM00408	Immunoglobulin subtype 2
IPR003599	159	246	SM00409	Immunoglobulin subtype
IPR003598	165	232	SM00408	Immunoglobulin subtype 2
IPR003599	265	346	SM00409	Immunoglobulin subtype
IPR003598	271	335	SM00408	Immunoglobulin subtype 2
IPR003599	355	438	SM00409	Immunoglobulin subtype
IPR003598	361	427	SM00408	Immunoglobulin subtype 2
IPR003599	449	531	SM00409	Immunoglobulin subtype
IPR003598	455	520	SM00408	Immunoglobulin subtype 2
IPR003599	540	622	SM00409	Immunoglobulin subtype
IPR003598	546	611	SM00408	Immunoglobulin subtype 2
IPR003961	635	718	SM00060	Fibronectin
IPR003961	735	818	SM00060	Fibronectin
IPR003961	834	925	SM00060	Fibronectin
IPR003961	940	1025	SM00060	Fibronectin
ProfileScan	IPR007110	53	141	PS50835	Immunoglobulin-like
IPR007110	148	242	PS50835	Immunoglobulin-like
IPR007110	255	344	PS50835	Immunoglobulin-like
IPR007110	349	436	PS50835	Immunoglobulin-like
IPR007110	442	529	PS50835	Immunoglobulin-like
IPR007110	534	620	PS50835	Immunoglobulin-like
IPR003961	635	727	PS50853	Fibronectin
IPR003961	734	828	PS50853	Fibronectin
IPR003961	833	935	PS50853	Fibronectin
IPR003961	940	1034	PS50853	Fibronectin
ScanRegExp	IPR003006	553	559	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 20 SAGRVPLILFLCQMISALEVPLD 42 SECONDARY 23

2 1051 GWFIGLMCAVALLILILLIVCFI 1073 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	20	SAGRVPLILFLCQMISALEVPLD	42	SECONDARY	23
2	1051	GWFIGLMCAVALLILILLIVCFI	1073	PRIMARY	23

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCATTCTTTATCCCCTGTTTG

Primer_r
: TCCACTGGGCTAGACACCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCATTCTTTATCCCCTGTTTG
Primer_r	: TCCACTGGGCTAGACACCTCC
PCR product length	: 124 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2261 bp
Genome contig ID	gi89161213r_107475330
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCAAAAAAGTAACTATTAAACAGTCTTGATCTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGACTTTTAACTTTTTCAAACATATATTGCCTAATGTTTTAAAATGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	107575330	107827273	26	99.2	Both No-hit

Gene/Protein Characteristic Table for KIAA0343

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information