| HUGE |
Gene/Protein Characteristic Table for KIAA0343 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01070 |
|---|---|
| Accession No. : | AB002341 |
| Description : | Neuronal cell adhesion molecule precursor. |
| HUGO Gene Name : | neuronal cell adhesion molecule (NRCAM) |
| Clone Name : | hg01457 [Vector Info] |
| Flexi ORF Clone : | pF1KA0343
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6218 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2261 bp Genome contig ID gi89161213r_107475330 PolyA signal sequence
(ATTAAA,-21)
TCAAAAAAGTAACTATTAAACAGTCTTGATCTCTTFlanking genome sequence
(100000 - 99951)
TGTGACTTTTAACTTTTTCAAACATATATTGCCTAATGTTTTAAAATGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 107575330 107827273 26 99.2 Both No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1187 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GCATTCTTTATCCCCTGTTTG | |
| : TCCACTGGGCTAGACACCTCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : GeneBridge 4 | |
| : GCATTCTTTATCCCCTGTTTG | |
| : TCCACTGGGCTAGACACCTCC | |
| : 124 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
