| HUGE | 
Gene/Protein Characteristic Table for KIAA1465 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00844 | 
|---|---|
| Accession No. : | AB040898 | 
| Description : | immunoglobulin superfamily containing leucine-rich repeat 2. | 
| HUGO Gene Name : | immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2) | 
| Clone Name : | fh13187 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA1465
                   ![]()  | 
| Source : | Human fetal brain | 
| Note : | We replaced fj00601, former representative clones for KIAA1465 with fh13187. (2002/5/10) | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4815 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | NO | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 1808 bp Genome contig ID gi51511731f_72108768 PolyA signal sequence 
(AATAAA,-18) +----*----+----*----+----*----+----
CGCGTCTGTATGCAGTCAATAAAACAATCGATTTGFlanking genome sequence 
(107428 - 107477) ----+----*----+----*----+----*----+----*----+----*
AACTGGGCTCGGTGACTTTTTGTCAGGGGACAGAGGGAGGAGGCCTGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 72208768 72216194 4 100.0 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 785 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
    Expression profile | 
Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : TGTTACACTGCATCGCCGACG | |
| : GCGTCAGCAAATCCCCATCTC | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 15 | 
| : CCR | |
| : TGTTACACTGCATCGCCGACG | |
| : GCGTCAGCAAATCCCCATCTC | |
| : 162 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |