HUGE

Gene/Protein Characteristic Table for KIAA1361

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00219
Accession No. :	AB037782
Description :	Serine/threonine-protein kinase TAO1.
HUGO Gene Name :	TAO kinase 1 (TAOK1)
Clone Name :	fj02367 [Vector Info]
Flexi ORF Clone :	pF1KA1361
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4620 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1462 bp

Genome contig ID gi51511734f_24702639
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACTACTGAAAAGGAACTAGGAAGTTTGGCCAATT
Flanking genome sequence
(192991 - 193040)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGTAAAATAAGTTATAGTGGTCAGGGAATCTCTTGACGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 24754920 24895628 20 99.5 Terminal No-hit

Features of the protein sequence	Description

Length: 1005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L7X3	100.0	Serine/threonin...	Homo sapiens
XP_537752	99.7	similar to TAO ...	Canis lupus fam...
AAG38502	99.8	STE20-like kina...	Homo sapiens
Q5F2E8	99.4	Serine/threonin...	Mus musculus
XP_001138763	99.2	TAO kinase 1 is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020688	2.5e-57	70.4	KIAA0881
D86959	3.3e-13	25.2	KIAA0204
AB011123	1.8e-12	30.9	KIAA0551
AB014587	6.4e-12	30.3	KIAA0687
AB032968	6.7e-11	36.7	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 35 275 PD000001 Protein kinase

IPR005602 450 604 PD038149 Protein of unknown function DUF334

HMMPfam IPR000719 32 285 PF00069 Protein kinase

HMMSmart IPR001245 32 283 SM00219 Tyrosine protein kinase

IPR002290 32 285 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 32 285 PS50011 Protein kinase

ScanRegExp IPR000719 38 62 PS00107 Protein kinase

IPR008271 151 163 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	35	275	PD000001	Protein kinase
IPR005602	450	604	PD038149	Protein of unknown function DUF334
HMMPfam	IPR000719	32	285	PF00069	Protein kinase
HMMSmart	IPR001245	32	283	SM00219	Tyrosine protein kinase
IPR002290	32	285	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	32	285	PS50011	Protein kinase
ScanRegExp	IPR000719	38	62	PS00107	Protein kinase
IPR008271	151	163	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGGAGATGAAGCTTACGTG

Primer_r
: AATATGGCATCAAACACCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1462 bp
Genome contig ID	gi51511734f_24702639
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTACTGAAAAGGAACTAGGAAGTTTGGCCAATT
Flanking genome sequence (192991 - 193040)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGTAAAATAAGTTATAGTGGTCAGGGAATCTCTTGACGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	24754920	24895628	20	99.5	Terminal No-hit

Primer_f	: TGAGGAGATGAAGCTTACGTG
Primer_r	: AATATGGCATCAAACACCTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1361

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information