HUGE

Gene/Protein Characteristic Table for KIAA0881

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00670
Accession No. :	AB020688
Description :	Serine/threonine-protein kinase TAO2.
HUGO Gene Name :	TAO kinase 2 (TAOK2)
Clone Name :	hk07534 [Vector Info]
Flexi ORF Clone :	pF1KSDA0881
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4242 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 689 bp

Genome contig ID gi51511732f_29793103
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGGCAAGCTTTTAATAAACTGTTGGTTATTCTAAC
Flanking genome sequence
(117979 - 118028)
----+----*----+----*----+----*----+----*----+----*
AGATCTCAGGACTCACCCTTCTGTCTTTGGTGTGCGTGAAGGACTGCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 29893103 29911080 19 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1064 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG38503	100.0	STE20-like kina...	Homo sapiens
XP_858335	99.6	similar to TAO ...	Canis lupus fam...
XP_872869	99.2	similar to TAO ...	Bos taurus
Q6ZQ29	98.0	Serine/threonin...	Mus musculus
XP_858414	98.1	similar to TAO ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037782	4.1e-48	70.4	KIAA1361
D86959	2.2e-11	24.7	KIAA0204
AB011123	4.5e-09	32.6	KIAA0551
AB032968	5.3e-09	36.2	KIAA1142
AB014587	1.8e-08	29.9	KIAA0687

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 46 286 PD000001 Protein kinase

HMMPfam IPR000719 43 296 PF00069 Protein kinase

HMMSmart IPR001245 43 295 SM00219 Tyrosine protein kinase

IPR002290 43 296 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 43 296 PS50011 Protein kinase

ScanRegExp IPR000719 49 73 PS00107 Protein kinase

IPR008271 162 174 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	46	286	PD000001	Protein kinase
HMMPfam	IPR000719	43	296	PF00069	Protein kinase
HMMSmart	IPR001245	43	295	SM00219	Tyrosine protein kinase
IPR002290	43	296	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	43	296	PS50011	Protein kinase
ScanRegExp	IPR000719	49	73	PS00107	Protein kinase
IPR008271	162	174	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAGGAAAGGAGGGAGATGTG

Primer_r
: AGACAGTTACGGGAAGAGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAGGAAAGGAGGGAGATGTG
Primer_r	: AGACAGTTACGGGAAGAGACC
PCR product length	: 244 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	689 bp
Genome contig ID	gi51511732f_29793103
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGGCAAGCTTTTAATAAACTGTTGGTTATTCTAAC
Flanking genome sequence (117979 - 118028)	----+--------+--------+--------+--------+----* AGATCTCAGGACTCACCCTTCTGTCTTTGGTGTGCGTGAAGGACTGCTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	29893103	29911080	19	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0881

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information