HUGE

Gene/Protein Characteristic Table for KIAA0204

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06896
Accession No. :	D86959
Description :	STE20-like serine/threonine-protein kinase.
HUGO Gene Name :	STE20-like kinase (yeast) (SLK)
Clone Name :	ha02801 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5988 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2018 bp

Genome contig ID gi89161187f_105616983
PolyA signal sequence
(GATAAA,-23)
+----*----+----*----+----*----+----
TTATATTGTTATGATAAAAATGACAGTATAATGTT
Flanking genome sequence
(160351 - 160400)
----+----*----+----*----+----*----+----*----+----*
GCCCAGTGTATTTAATGATTTATTTGAAGAGGGATTGGGAAGGAACGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 105716983 105777332 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA19655	99.7	hSLK [Homo sapi...	Homo sapiens
XP_001137318	99.2	serine/threonin...	Pan troglodytes
XP_001114185	96.8	similar to seri...	Macaca mulatta
XP_001497765	87.8	STE20-like kina...	Equus caballus
XP_001929461	88.8	STE20-like kina...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011123	3e-16	26.6	KIAA0551
AB014587	7.9e-15	26.6	KIAA0687
AB020688	6e-14	24.7	KIAA0881
AB037782	4.2e-13	25.4	KIAA1361
AB032968	1.7e-11	33.6	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 47 292 PD000001 Protein kinase

HMMPfam IPR000719 46 304 PF00069 Protein kinase

HMMSmart IPR001245 46 304 SM00219 Tyrosine protein kinase

IPR002290 46 304 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 46 304 PS50011 Protein kinase

IPR001943 887 922 PS50151 UvrB/UvrC protein

ScanRegExp IPR000719 52 75 PS00107 Protein kinase

IPR008271 163 175 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	47	292	PD000001	Protein kinase
HMMPfam	IPR000719	46	304	PF00069	Protein kinase
HMMSmart	IPR001245	46	304	SM00219	Tyrosine protein kinase
IPR002290	46	304	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	46	304	PS50011	Protein kinase
IPR001943	887	922	PS50151	UvrB/UvrC protein
ScanRegExp	IPR000719	52	75	PS00107	Protein kinase
IPR008271	163	175	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GAAAACTTTGGATGCTGAACC
Primer_r	: CTACCTACGAAGTTGTCCAAG
PCR product length	: 120 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2018 bp
Genome contig ID	gi89161187f_105616983
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- TTATATTGTTATGATAAAAATGACAGTATAATGTT
Flanking genome sequence (160351 - 160400)	----+--------+--------+--------+--------+----* GCCCAGTGTATTTAATGATTTATTTGAAGAGGGATTGGGAAGGAACGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	105716983	105777332	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0204

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information