HUGE

Gene/Protein Characteristic Table for KIAA1352

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01162
Accession No. :	AB037773
Description :	Leucyl-tRNA synthetase, cytoplasmic.
HUGO Gene Name :
Clone Name :	fj01313 [Vector Info]
Flexi ORF Clone :	pF1KA1352
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3893 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 195 bp

Genome contig ID gi51511721r_145373682
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGATTCCTGGACCTAATAAATTTTTTTTCCCTTTC
Flanking genome sequence
(99985 - 99936)
----+----*----+----*----+----*----+----*----+----*
TTTGGGTGTCCAAGAGAAATGGTTTTTGCCAAACTCTTTTTAAAAAACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 145473667 145542416 32 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1212 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2J5	100.0	Leucyl-tRNA syn...	Homo sapiens
BAG37619	99.8	unnamed protein...	Homo sapiens
BAA95667	99.7	leucyl tRNA syn...	Homo sapiens
XP_001157096	99.6	cytosolic leucy...	Pan troglodytes
XP_001156890	99.6	cytosolic leucy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D21851	0.00016	26.4	KIAA0028

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR015413 737 791 PF09334 Aminoacyl-tRNA synthetase

IPR013155 830 966 PF08264 Valyl/Leucyl/Isoleucyl-tRNA synthetase

HMMTigr IPR004493 50 1098 TIGR00395 Leucyl-tRNA synthetase

ScanRegExp IPR001412 89 100 PS00178 Aminoacyl-tRNA synthetase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015413	737	791	PF09334	Aminoacyl-tRNA synthetase
IPR013155	830	966	PF08264	Valyl/Leucyl/Isoleucyl-tRNA synthetase
HMMTigr	IPR004493	50	1098	TIGR00395	Leucyl-tRNA synthetase
ScanRegExp	IPR001412	89	100	PS00178	Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGCTGTTTTCAATGTGGACC

Primer_r
: CCAATCAGTAGACACAATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	195 bp
Genome contig ID	gi51511721r_145373682
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGATTCCTGGACCTAATAAATTTTTTTTCCCTTTC
Flanking genome sequence (99985 - 99936)	----+--------+--------+--------+--------+----* TTTGGGTGTCCAAGAGAAATGGTTTTTGCCAAACTCTTTTTAAAAAACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	145473667	145542416	32	100.0	Perfect prediction

Primer_f	: ATGCTGTTTTCAATGTGGACC
Primer_r	: CCAATCAGTAGACACAATCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1352

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information