HUGE |
Gene/Protein Characteristic Table for KIAA0028 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00374 |
---|---|
Accession No. : | D21851 |
Description : | Probable leucyl-tRNA synthetase, mitochondrial precursor. |
HUGO Gene Name : | leucyl-tRNA synthetase 2, mitochondrial (LARS2) |
Clone Name : | ha00560 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0028
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4203 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1306 bp Genome contig ID gi89161205f_45305079 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ACTTTTTTAGTGTAATAAAATGTTTATCATCTATGFlanking genome sequence
(260255 - 260304) ----+----*----+----*----+----*----+----*----+----*
ACTTCAGGACATATGTGTGATCCTGGAATACACCATATTCCAATTTCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 45405079 45565332 22 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 904 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Genebridge 4 | |
: GGGAAGCCATCAGAGACACT | |
: CTGAAGGCAAAGAGACCATT | |
: 216 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |