HUGE |
Gene/Protein Characteristic Table for KIAA1348 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00810 |
---|---|
Accession No. : | AB037769 |
Description : | [Pyruvate dehydrogenase [lipoamide]]-phosphatase 2, mitochondrial precursor. |
HUGO Gene Name : | |
Clone Name : | fj00937 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1348
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3830 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2078 bp Genome contig ID gi51511732f_65371937 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAAGAGTGAAACTCTGTCTCFlanking genome sequence
(107421 - 107470) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAATCCATCTTATCTCTTAGTCCGTCCTTCCTTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 65471937 65479356 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 545 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014045 | 121 | 503 | PF00481 | Protein phosphatase 2C |
HMMSmart | IPR001932 | 109 | 531 | SM00332 | Protein phosphatase 2C-related |
ScanRegExp | IPR000222 | 152 | 160 | PS01032 | Protein phosphatase 2C |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACCACCATTGCTAGTCCTCAG | |
: CAAAGAGTCTACAGCCCACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: ACCACCATTGCTAGTCCTCAG | |
: CAAAGAGTCTACAGCCCACAG | |
: 104 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |