HUGE

Gene/Protein Characteristic Table for KIAA1306

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04438
Accession No. :	AB037727
Description :	Caskin-1.
HUGO Gene Name :	CASK interacting protein 1 (CASKIN1)
Clone Name :	fh05845 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4832 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1367 bp

Genome contig ID gi51511732r_2067185
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCGCTGCCGTCGGCTGTCAATAAACAGCAGGAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGGTGCCTGGCTCACTTTTTGGGGGCACATGTGTTGGGGGAGATGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 2167185 2177078 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85543	100.0	CASK interactin...	Homo sapiens
Q8WXD9	100.0	Caskin-1; CASK-...	Homo sapiens
XP_001084114	97.1	similar to CASK...	Macaca mulatta
EAW85544	99.7	CASK interactin...	Homo sapiens
NP_542421	88.1	CASK interactin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032965	9.9e-14	36.7	KIAA1139

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011511 8 68 PF07653 Variant SH3

IPR001660 193 256 PF00536 Sterile alpha motif SAM

IPR001660 272 326 PF00536 Sterile alpha motif SAM

HMMSmart IPR001452 7 69 SM00326 Src homology-3

IPR001660 192 258 SM00454 Sterile alpha motif SAM

IPR001660 261 328 SM00454 Sterile alpha motif SAM

ProfileScan IPR001452 4 70 PS50002 Src homology-3

IPR001660 195 258 PS50105 Sterile alpha motif SAM

IPR001660 264 328 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011511	8	68	PF07653	Variant SH3
IPR001660	193	256	PF00536	Sterile alpha motif SAM
IPR001660	272	326	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001452	7	69	SM00326	Src homology-3
IPR001660	192	258	SM00454	Sterile alpha motif SAM
IPR001660	261	328	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001452	4	70	PS50002	Src homology-3
IPR001660	195	258	PS50105	Sterile alpha motif SAM
IPR001660	264	328	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCCCTCCAAGAAGTACTGAC

Primer_r
: ACAATCGCTGGTTTTCGGCAT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1367 bp
Genome contig ID	gi51511732r_2067185
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCGCTGCCGTCGGCTGTCAATAAACAGCAGGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGGTGCCTGGCTCACTTTTTGGGGGCACATGTGTTGGGGGAGATGGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	2167185	2177078	12	100.0	Perfect prediction

Primer_f	: CCCCCTCCAAGAAGTACTGAC
Primer_r	: ACAATCGCTGGTTTTCGGCAT
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1306

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information