HUGE

Gene/Protein Characteristic Table for KIAA1139

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04439
Accession No. :	AB032965
Description :	Caskin-2.
HUGO Gene Name :	CASK interacting protein 2 (CASKIN2)
Clone Name :	hk00330 [Vector Info]
Flexi ORF Clone :	pF1KA1139
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4193 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 818 bp

Genome contig ID gi51511734r_70907938
PolyA signal sequence
(AATGAA,-22)
+----*----+----*----+----*----+----
CCCAACTAACACCAATGAAAACACCATTCCACGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGGGCTGTGTGTTTGCCTCTGTGACATGGGGACCCCTGACCCTAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 71007938 71014814 16 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1124 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WXE0	100.0	Caskin-2.	Homo sapiens
NP_065804	99.9	cask-interactin...	Homo sapiens
BAG62095	99.9	unnamed protein...	Homo sapiens
BAH14307	99.8	unnamed protein...	Homo sapiens
XP_001097098	98.0	similar to cask...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037727	7.1e-14	36.9	KIAA1306
D86982	1.4e-06	28.9	KIAA0229

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 37 49 PR01415 Ankyrin

IPR002110 155 167 PR01415 Ankyrin

NULL 704 716 PR01217 NULL

NULL 762 774 PR01217 NULL

NULL 799 820 PR01217 NULL

NULL 828 844 PR01217 NULL

NULL 846 863 PR01217 NULL

NULL 938 963 PR01217 NULL

HMMPfam IPR002110 3 35 PF00023 Ankyrin

IPR002110 36 68 PF00023 Ankyrin

IPR002110 69 91 PF00023 Ankyrin

IPR002110 110 142 PF00023 Ankyrin

IPR002110 145 174 PF00023 Ankyrin

IPR011511 207 267 PF07653 Variant SH3

IPR001660 409 472 PF00536 Sterile alpha motif SAM

IPR001660 478 542 PF00536 Sterile alpha motif SAM

HMMSmart IPR002110 3 32 SM00248 Ankyrin

IPR002110 36 65 SM00248 Ankyrin

IPR002110 69 98 SM00248 Ankyrin

IPR002110 110 139 SM00248 Ankyrin

IPR002110 142 171 SM00248 Ankyrin

IPR001452 206 268 SM00326 Src homology-3

IPR001660 408 474 SM00454 Sterile alpha motif SAM

IPR001660 477 544 SM00454 Sterile alpha motif SAM

ProfileScan IPR002110 1 180 PS50297 Ankyrin

IPR002110 3 35 PS50088 Ankyrin

IPR002110 36 68 PS50088 Ankyrin

IPR002110 110 142 PS50088 Ankyrin

IPR002110 142 174 PS50088 Ankyrin

IPR001452 203 269 PS50002 Src homology-3

IPR001660 411 474 PS50105 Sterile alpha motif SAM

IPR001660 480 544 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	37	49	PR01415	Ankyrin
IPR002110	155	167	PR01415	Ankyrin
NULL	704	716	PR01217	NULL
NULL	762	774	PR01217	NULL
NULL	799	820	PR01217	NULL
NULL	828	844	PR01217	NULL
NULL	846	863	PR01217	NULL
NULL	938	963	PR01217	NULL
HMMPfam	IPR002110	3	35	PF00023	Ankyrin
IPR002110	36	68	PF00023	Ankyrin
IPR002110	69	91	PF00023	Ankyrin
IPR002110	110	142	PF00023	Ankyrin
IPR002110	145	174	PF00023	Ankyrin
IPR011511	207	267	PF07653	Variant SH3
IPR001660	409	472	PF00536	Sterile alpha motif SAM
IPR001660	478	542	PF00536	Sterile alpha motif SAM
HMMSmart	IPR002110	3	32	SM00248	Ankyrin
IPR002110	36	65	SM00248	Ankyrin
IPR002110	69	98	SM00248	Ankyrin
IPR002110	110	139	SM00248	Ankyrin
IPR002110	142	171	SM00248	Ankyrin
IPR001452	206	268	SM00326	Src homology-3
IPR001660	408	474	SM00454	Sterile alpha motif SAM
IPR001660	477	544	SM00454	Sterile alpha motif SAM
ProfileScan	IPR002110	1	180	PS50297	Ankyrin
IPR002110	3	35	PS50088	Ankyrin
IPR002110	36	68	PS50088	Ankyrin
IPR002110	110	142	PS50088	Ankyrin
IPR002110	142	174	PS50088	Ankyrin
IPR001452	203	269	PS50002	Src homology-3
IPR001660	411	474	PS50105	Sterile alpha motif SAM
IPR001660	480	544	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTGTATGGCAAGACCGAGG

Primer_r
: ATTGAGAGCAGTGGGATCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTGTATGGCAAGACCGAGG
Primer_r	: ATTGAGAGCAGTGGGATCGTG
PCR product length	: 221 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	818 bp
Genome contig ID	gi51511734r_70907938
PolyA signal sequence (AATGAA,-22)	+--------+--------+----*----+---- CCCAACTAACACCAATGAAAACACCATTCCACGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGGGCTGTGTGTTTGCCTCTGTGACATGGGGACCCCTGACCCTAGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	71007938	71014814	16	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1139

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information