HUGE

Gene/Protein Characteristic Table for KIAA1301

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00211
Accession No. :	AB037722
Description :	E3 ubiquitin-protein ligase HECW2.
HUGO Gene Name :	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (HECW2)
Clone Name :	fg06833 [Vector Info]
Flexi ORF Clone :	pF1KA1301
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6926 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2024 bp

Genome contig ID gi89161199r_196672222
PolyA signal sequence
(AATACA,-25)
+----*----+----*----+----*----+----
ATTGATCATGAATACAAGTATATATTTAATTTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTTTCACTTGTTTGTATTCTTTTCATTATAAGGAAAAGTAGTATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 196772222 197165580 29 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1581 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2P5	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_516001	99.6	HECT, C2 and WW...	Pan troglodytes
XP_001917812	96.6	HECT, C2 and WW...	Equus caballus
Q6I6G8	94.7	E3 ubiquitin-pr...	Mus musculus
EDL99066	94.3	similar to HECT...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002320	7.4e-132	57.0	KIAA0322
AB007899	2.3e-49	36.0	KIAA0439
D42055	1.2e-43	36.8	KIAA0093
AB046845	3.6e-39	45.9	KIAA1625
AB002310	6.9e-32	34.5	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 196 291 PF00168 C2 calcium-dependent membrane targeting

IPR001202 818 847 PF00397 WW/Rsp5/WWP

IPR001202 996 1025 PF00397 WW/Rsp5/WWP

IPR000569 1276 1581 PF00632 HECT

HMMSmart IPR000008 195 306 SM00239 C2 calcium-dependent membrane targeting

IPR001202 817 849 SM00456 WW/Rsp5/WWP

IPR001202 995 1027 SM00456 WW/Rsp5/WWP

IPR000569 1244 1581 SM00119 HECT

ProfileScan IPR000008 195 291 PS50004 C2 calcium-dependent membrane targeting

IPR001202 816 849 PS50020 WW/Rsp5/WWP

IPR001202 994 1027 PS50020 WW/Rsp5/WWP

IPR000569 1246 1581 PS50237 HECT

ScanRegExp IPR001202 822 847 PS01159 WW/Rsp5/WWP

IPR001202 1000 1025 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	196	291	PF00168	C2 calcium-dependent membrane targeting
IPR001202	818	847	PF00397	WW/Rsp5/WWP
IPR001202	996	1025	PF00397	WW/Rsp5/WWP
IPR000569	1276	1581	PF00632	HECT
HMMSmart	IPR000008	195	306	SM00239	C2 calcium-dependent membrane targeting
IPR001202	817	849	SM00456	WW/Rsp5/WWP
IPR001202	995	1027	SM00456	WW/Rsp5/WWP
IPR000569	1244	1581	SM00119	HECT
ProfileScan	IPR000008	195	291	PS50004	C2 calcium-dependent membrane targeting
IPR001202	816	849	PS50020	WW/Rsp5/WWP
IPR001202	994	1027	PS50020	WW/Rsp5/WWP
IPR000569	1246	1581	PS50237	HECT
ScanRegExp	IPR001202	822	847	PS01159	WW/Rsp5/WWP
IPR001202	1000	1025	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACATGGTTCCAGTGGCTTAC

Primer_r
: AACATAACAAGGTCTGCATCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGACACAGGGACTTCCGATGC
Primer_r	: TGGTCACACTCTCATTGCAGG
PCR product length	: 212 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2024 bp
Genome contig ID	gi89161199r_196672222
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- ATTGATCATGAATACAAGTATATATTTAATTTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTTCACTTGTTTGTATTCTTTTCATTATAAGGAAAAGTAGTATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	196772222	197165580	29	99.5	Perfect prediction

Primer_f	: GACATGGTTCCAGTGGCTTAC
Primer_r	: AACATAACAAGGTCTGCATCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1301

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information