HUGE

Gene/Protein Characteristic Table for KIAA0312

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05590
Accession No. :	AB002310
Description :	E3 ubiquitin-protein ligase HUWE1.
HUGO Gene Name :	HECT, UBA and WWE domain containing 1 (HUWE1)
Clone Name :	ff01724 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hg00137, former representative clones for KIAA0312 with ff01724. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1211 bp

Genome contig ID gi89161218r_53475828
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
AATTTAATAAAAATTTAGTTAGAAAAAATAACCCC
Flanking genome sequence
(99956 - 99907)
----+----*----+----*----+----*----+----*----+----*
AAGTGGTGCTTGCCTTGTGTGGTTTTTCTCATTTTCCTGGGGTGCTACCT

Features of the protein sequence	Description

Length: 3192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001088879	99.6	similar to HECT...	Macaca mulatta
EAW93160	99.0	HECT, UBA and W...	Homo sapiens
XP_001362150	89.3	similar to HECT...	Monodelphis dom...
XP_001923899	76.9	similar to HECT...	Danio rerio
XP_001914766	97.4	HECT, UBA and W...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046798	2.9e-194	98.2	KIAA1578
AB007899	6.9e-27	37.4	KIAA0439
D42055	2.5e-26	48.7	KIAA0093
AB046845	3.9e-25	45.5	KIAA1625
AB037722	5.2e-23	34.4	KIAA1301

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 152 190 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR004170 444 515 PF02825 WWE

IPR000569 2885 3192 PF00632 HECT

HMMSmart IPR000449 153 189 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

IPR000569 2854 3192 SM00119 HECT

ProfileScan IPR000449 151 190 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

IPR004170 438 515 PS50918 WWE

IPR000569 2856 3192 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	152	190	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR004170	444	515	PF02825	WWE
IPR000569	2885	3192	PF00632	HECT
HMMSmart	IPR000449	153	189	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
IPR000569	2854	3192	SM00119	HECT
ProfileScan	IPR000449	151	190	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
IPR004170	438	515	PS50918	WWE
IPR000569	2856	3192	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGCCCAAAGCCTTCAGAGCAC

Primer_r
: ATCGAGATGACAGGTCCACAG

PCR conditions
: 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCCCAAAGCCTTCAGAGCAC
Primer_r	: ATCGAGATGACAGGTCCACAG
PCR product length	: 141 (0.8k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1211 bp
Genome contig ID	gi89161218r_53475828
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AATTTAATAAAAATTTAGTTAGAAAAAATAACCCC
Flanking genome sequence (99956 - 99907)	----+--------+--------+--------+--------+----* AAGTGGTGCTTGCCTTGTGTGGTTTTTCTCATTTTCCTGGGGTGCTACCT

Gene/Protein Characteristic Table for KIAA0312

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information