HUGE

Gene/Protein Characteristic Table for KIAA1259

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00785
Accession No. :	AB033085
Description :	Putative DNA helicase INO80 complex homolog 1.
HUGO Gene Name :	INO80 homolog (S. cerevisiae) (INO80)
Clone Name :	hh15706 [Vector Info]
Flexi ORF Clone :	pF1KSDA1259
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5979 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1095 bp

Genome contig ID gi51511731r_38958383
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGGATAAAAAAATCTTAAATAAAATGGAGTGAGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTATGTAAATTGAGGTGTCTGTGGTCTTTGCAGCTGCCCCTCCTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 39058383 39195632 37 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1561 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULG1	100.0	Putative DNA he...	Homo sapiens
XP_510320	99.9	INO80 complex h...	Pan troglodytes
XP_849183	98.3	similar to yeas...	Canis lupus fam...
XP_001503533	97.8	INO80 complex h...	Equus caballus
XP_874470	97.6	similar to Puta...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	5.4e-20	45.1	KIAA0309
AB007913	4.9e-15	47.6	KIAA0444
AB040931	6.4e-15	27.6	KIAA1498
AB032948	3.7e-14	25.8	KIAA1122
AB002306	1.1e-13	24.5	KIAA0308

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 526 827 PF00176 SNF2-related

IPR001650 1141 1219 PF00271 DNA/RNA helicase

HMMSmart IPR014001 519 717 SM00487 DEAD-like helicases

IPR001650 1136 1219 SM00490 DNA/RNA helicase

ProfileScan IPR014021 535 706 PS51192 Helicase

IPR001650 1110 1265 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	526	827	PF00176	SNF2-related
IPR001650	1141	1219	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	519	717	SM00487	DEAD-like helicases
IPR001650	1136	1219	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	535	706	PS51192	Helicase
IPR001650	1110	1265	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGTCAGAAGTGGAAATGTC

Primer_r
: TGGCTATACAGTTCACTTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1095 bp
Genome contig ID	gi51511731r_38958383
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGGATAAAAAAATCTTAAATAAAATGGAGTGAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTATGTAAATTGAGGTGTCTGTGGTCTTTGCAGCTGCCCCTCCTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	39058383	39195632	37	99.8	Perfect prediction

Primer_f	: TGAGTCAGAAGTGGAAATGTC
Primer_r	: TGGCTATACAGTTCACTTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1259

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information