HUGE

Gene/Protein Characteristic Table for KIAA1041

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02015
Accession No. :	AB028964
Description :	Forkhead box protein J3.
HUGO Gene Name :	forkhead box J3 (FOXJ3)
Clone Name :	fh02801 [Vector Info]
Flexi ORF Clone :	pF1KA1041
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3160 bp

Genome contig ID gi89161185r_42314807
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AATGGCACTTAAAATAAATATATTATGTTAACTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTACAACACTGATTGGTCTCCGTTGTTTGCTGTAATTGAAGAAGTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 42414807 42573223 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 642 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPW0	7.2e-201	100.0	Forkhead box pr...	Homo sapiens
AAI51829	2.5e-200	99.8	Forkhead box J3...	Homo sapiens
XP_001085783	3.5e-200	99.7	similar to fork...	Macaca mulatta
EAX07162	4.3e-200	99.7	forkhead box J3...	Homo sapiens
XP_001172886	2.5e-195	99.8	forkhead box J3...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001766 101 175 PD000425 Fork head transcription factor

FPrintScan IPR001766 98 111 PR00053 Fork head transcription factor

IPR001766 119 136 PR00053 Fork head transcription factor

IPR001766 142 159 PR00053 Fork head transcription factor

HMMPfam IPR001766 98 197 PF00250 Fork head transcription factor

HMMSmart IPR001766 96 186 SM00339 Fork head transcription factor

ProfileScan IPR001766 98 193 PS50039 Fork head transcription factor

ScanRegExp IPR001766 98 111 PS00657 Fork head transcription factor

IPR001766 142 148 PS00658 Fork head transcription factor

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001766	101	175	PD000425	Fork head transcription factor
FPrintScan	IPR001766	98	111	PR00053	Fork head transcription factor
IPR001766	119	136	PR00053	Fork head transcription factor
IPR001766	142	159	PR00053	Fork head transcription factor
HMMPfam	IPR001766	98	197	PF00250	Fork head transcription factor
HMMSmart	IPR001766	96	186	SM00339	Fork head transcription factor
ProfileScan	IPR001766	98	193	PS50039	Fork head transcription factor
ScanRegExp	IPR001766	98	111	PS00657	Fork head transcription factor
IPR001766	142	148	PS00658	Fork head transcription factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCAGCAACAATCCTAATGAC

Primer_r
: CCTCTATGATGAACGGCAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3160 bp
Genome contig ID	gi89161185r_42314807
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATGGCACTTAAAATAAATATATTATGTTAACTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTACAACACTGATTGGTCTCCGTTGTTTGCTGTAATTGAAGAAGTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	42414807	42573223	15	99.3	Perfect prediction

Primer_f	: GGCAGCAACAATCCTAATGAC
Primer_r	: CCTCTATGATGAACGGCAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1041

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information