HUGE

Gene/Protein Characteristic Table for KIAA0967

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00702
Accession No. :	AB023184
Description :	FERM and PDZ domain containing 1.
HUGO Gene Name :	FERM and PDZ domain containing 1 (FRMPD1)
Clone Name :	hj06404 [Vector Info]
Flexi ORF Clone :	pF1KSDA0967
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4916 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 135 bp

Genome contig ID gi89161216f_37541052
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TATAGAGTATTCAAATAAACTGCTGCTTAATCTTG
Flanking genome sequence
(195851 - 195900)
----+----*----+----*----+----*----+----*----+----*
GCCTGAGTCATAGAGTTTGGGTTAAAAGCATTCACTTATATTCGTTCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 37641052 37736901 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5SYB0	99.9	FERM and PDZ do...	Homo sapiens
AAI14966	99.9	FERM and PDZ do...	Homo sapiens
CAI46019	99.7	hypothetical pr...	Homo sapiens
XP_520428	98.9	FERM and PDZ do...	Pan troglodytes
XP_001114750	96.7	similar to FERM...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002314	1e-48	30.3	KIAA0316

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 57 132 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 67 135 SM00228 PDZ/DHR/GLGF

IPR000299 177 401 SM00295 Band 4.1

ProfileScan IPR001478 57 135 PS50106 PDZ/DHR/GLGF

IPR000299 181 496 PS50057 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	57	132	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	67	135	SM00228	PDZ/DHR/GLGF
IPR000299	177	401	SM00295	Band 4.1
ProfileScan	IPR001478	57	135	PS50106	PDZ/DHR/GLGF
IPR000299	181	496	PS50057	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGGGACTTGGAAGCACACC

Primer_r
: CAGATGTGGCTTTTCCTCGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGGGACTTGGAAGCACACC
Primer_r	: CAGATGTGGCTTTTCCTCGAC
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	135 bp
Genome contig ID	gi89161216f_37541052
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TATAGAGTATTCAAATAAACTGCTGCTTAATCTTG
Flanking genome sequence (195851 - 195900)	----+--------+--------+--------+--------+----* GCCTGAGTCATAGAGTTTGGGTTAAAAGCATTCACTTATATTCGTTCAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	37641052	37736901	16	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0967

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information