| HUGE |
Gene/Protein Characteristic Table for KIAA0316 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00502 |
|---|---|
| Accession No. : | AB002314 |
| Description : | FERM and PDZ domain containing 4. |
| HUGO Gene Name : | FERM and PDZ domain containing 4 (FRMPD4) |
| Clone Name : | fg06820 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0316
|
| Source : | Human fetal brain |
| Note : | We replaced hg00253, former representative clones for KIAA0316 with fg06820. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6352 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1877 bp Genome contig ID gi89161218f_11966506 PolyA signal sequence
(AATAAA,-22)
AGAATATATCTGTAATAAATTAATTTTTTGCTCATFlanking genome sequence
(683946 - 683995)
AGTATTTGGTTACTGGATGCTTTCTTCCAAGAATCCCACATATTTAATTT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1379 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GATTTTGTCCCAGTACTACGC | |
| : CAGTAATGTAGACCAGACCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : GeneBridge 4 | |
| : GATTTTGTCCCAGTACTACGC | |
| : CAGTAATGTAGACCAGACCAC | |
| : 148 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
