| HUGE |
Gene/Protein Characteristic Table for KIAA0939 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00690 |
|---|---|
| Accession No. : | AB023156 |
| Description : | Sodium/hydrogen exchanger 8. |
| HUGO Gene Name : | solute carrier family 9 (sodium/hydrogen exchanger), member 8 (SLC9A8) |
| Clone Name : | hh04825s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0939
![]() |
| Source : | Human adult brain |
| Note : | We replaced hh04825, former representative clones for KIAA0939 with hh04825s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6087 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4299 bp Genome contig ID gi51511747f_47762825 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGGATGCCTATTTAGAAATAAAGTGTATGCTGCTGFlanking genome sequence
(179356 - 179405) ----+----*----+----*----+----*----+----*----+----*
AATTGGAGCCAGTGTCTGTGTTCATGTTCAGGTGGCTTTGCAGATGCACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 47862825 47942179 16 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 595 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GTAAAAATGACGAGTGCTGGG | |
| : CCAAGAAGAGCAGCACATCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |