HUGE

Gene/Protein Characteristic Table for KIAA0823

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01607
Accession No. :	AB020630
Description :	Protein phosphatase 1 regulatory inhibitor subunit 16B.
HUGO Gene Name :	protein phosphatase 1, regulatory (inhibitor) subunit 16B (PPP1R16B)
Clone Name :	hh02763s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0823
Source :	Human adult brain
Note :	We replaced hh02763, former representative clones for KIAA0823 with hh02763s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4357 bp

Genome contig ID gi51511747f_36767762
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTTTTAATTAAAATTATTAAATTCCTTTTAATAAC
Flanking genome sequence
(217320 - 217369)
----+----*----+----*----+----*----+----*----+----*
ACCTGCTAGTGTGAGTGATTATTGCTGTGAGCTCACTTGAACAGTGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 36867762 36985080 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96T49	100.0	Protein phospha...	Homo sapiens
XP_542995	97.2	similar to Prot...	Canis lupus fam...
Q95N27	96.8	Protein phospha...	Bos taurus
Q8VHQ3	96.3	Protein phospha...	Mus musculus
XP_001058014	95.8	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020672	3e-20	29.2	KIAA0865
AB002377	3.4e-09	29.8	KIAA0379
AB018314	2.6e-08	36.6	KIAA0771
AB033076	1.7e-07	27.6	KIAA1250
AB014597	2.1e-07	24.7	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 145 157 PR01415 Ankyrin

IPR002110 157 169 PR01415 Ankyrin

HMMPfam IPR002110 82 110 PF00023 Ankyrin

IPR002110 111 143 PF00023 Ankyrin

IPR002110 144 176 PF00023 Ankyrin

IPR002110 239 271 PF00023 Ankyrin

IPR002110 272 304 PF00023 Ankyrin

HMMSmart IPR002110 78 107 SM00248 Ankyrin

IPR002110 111 140 SM00248 Ankyrin

IPR002110 144 173 SM00248 Ankyrin

IPR002110 239 268 SM00248 Ankyrin

IPR002110 272 301 SM00248 Ankyrin

ProfileScan IPR002110 78 304 PS50297 Ankyrin

IPR002110 111 143 PS50088 Ankyrin

IPR002110 144 176 PS50088 Ankyrin

IPR002110 239 271 PS50088 Ankyrin

IPR002110 272 304 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	145	157	PR01415	Ankyrin
IPR002110	157	169	PR01415	Ankyrin
HMMPfam	IPR002110	82	110	PF00023	Ankyrin
IPR002110	111	143	PF00023	Ankyrin
IPR002110	144	176	PF00023	Ankyrin
IPR002110	239	271	PF00023	Ankyrin
IPR002110	272	304	PF00023	Ankyrin
HMMSmart	IPR002110	78	107	SM00248	Ankyrin
IPR002110	111	140	SM00248	Ankyrin
IPR002110	144	173	SM00248	Ankyrin
IPR002110	239	268	SM00248	Ankyrin
IPR002110	272	301	SM00248	Ankyrin
ProfileScan	IPR002110	78	304	PS50297	Ankyrin
IPR002110	111	143	PS50088	Ankyrin
IPR002110	144	176	PS50088	Ankyrin
IPR002110	239	271	PS50088	Ankyrin
IPR002110	272	304	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGAGGTAACTTCCACGTAGC

Primer_r
: AAGCAACTCCAGGGACATGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4357 bp
Genome contig ID	gi51511747f_36767762
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTTTAATTAAAATTATTAAATTCCTTTTAATAAC
Flanking genome sequence (217320 - 217369)	----+--------+--------+--------+--------+----* ACCTGCTAGTGTGAGTGATTATTGCTGTGAGCTCACTTGAACAGTGCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	36867762	36985080	11	99.2	Perfect prediction

Primer_f	: CTGAGGTAACTTCCACGTAGC
Primer_r	: AAGCAACTCCAGGGACATGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0823

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information