HUGE

Gene/Protein Characteristic Table for KIAA0848

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00657
Accession No. :	AB020655
Description :	SLIT and NTRK-like protein 3 precursor.
HUGO Gene Name :	SLIT and NTRK-like family, member 3 (SLITRK3)
Clone Name :	hk05607 [Vector Info]
Flexi ORF Clone :	pF1KSDA0848
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4220 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1175 bp

Genome contig ID gi89161205r_166287204
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TATAGCTTTCCTAATAAAAAGTTTTTGAAAAACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATACATTATATATAGAGGATACAAAGCTTGAACCTTAAACTCCAGCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 166387204 166397163 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 988 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526372	99.6	slit and trk li...	Pan troglodytes
BAG09869	100.0	SLIT and NTRK-l...	synthetic construct
O94933	99.9	SLIT and NTRK-l...	Homo sapiens
XP_851171	98.3	similar to slit...	Canis lupus fam...
XP_001504616	97.4	SLIT and NTRK-l...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020725	1.6e-78	42.2	KIAA0918
AB058757	1.8e-34	50.3	KIAA1854
AB067497	1.2e-27	38.9	KIAA1910
AB011538	5.7e-09	25.3	KIAA0814
AB007865	8.1e-07	27.9	KIAA0405

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 209 222 PR00019 Leucine-rich repeat

IPR001611 466 479 PR00019 Leucine-rich repeat

HMMPfam IPR001611 113 135 PF00560 Leucine-rich repeat

IPR001611 161 183 PF00560 Leucine-rich repeat

IPR001611 185 207 PF00560 Leucine-rich repeat

IPR001611 208 231 PF00560 Leucine-rich repeat

IPR001611 420 442 PF00560 Leucine-rich repeat

IPR001611 444 466 PF00560 Leucine-rich repeat

IPR001611 468 490 PF00560 Leucine-rich repeat

IPR001611 492 514 PF00560 Leucine-rich repeat

IPR001611 516 538 PF00560 Leucine-rich repeat

HMMSmart IPR003591 111 134 SM00369 Leucine-rich repeat

IPR003591 135 158 SM00369 Leucine-rich repeat

IPR003591 159 182 SM00369 Leucine-rich repeat

IPR003591 183 206 SM00369 Leucine-rich repeat

IPR003591 207 230 SM00369 Leucine-rich repeat

IPR000483 243 293 SM00082 Cysteine-rich flanking region

IPR003591 442 465 SM00369 Leucine-rich repeat

IPR003591 466 489 SM00369 Leucine-rich repeat

IPR003591 490 513 SM00369 Leucine-rich repeat

IPR003591 514 537 SM00369 Leucine-rich repeat

IPR000483 573 623 SM00082 Cysteine-rich flanking region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	209	222	PR00019	Leucine-rich repeat
IPR001611	466	479	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	113	135	PF00560	Leucine-rich repeat
IPR001611	161	183	PF00560	Leucine-rich repeat
IPR001611	185	207	PF00560	Leucine-rich repeat
IPR001611	208	231	PF00560	Leucine-rich repeat
IPR001611	420	442	PF00560	Leucine-rich repeat
IPR001611	444	466	PF00560	Leucine-rich repeat
IPR001611	468	490	PF00560	Leucine-rich repeat
IPR001611	492	514	PF00560	Leucine-rich repeat
IPR001611	516	538	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	111	134	SM00369	Leucine-rich repeat
IPR003591	135	158	SM00369	Leucine-rich repeat
IPR003591	159	182	SM00369	Leucine-rich repeat
IPR003591	183	206	SM00369	Leucine-rich repeat
IPR003591	207	230	SM00369	Leucine-rich repeat
IPR000483	243	293	SM00082	Cysteine-rich flanking region
IPR003591	442	465	SM00369	Leucine-rich repeat
IPR003591	466	489	SM00369	Leucine-rich repeat
IPR003591	490	513	SM00369	Leucine-rich repeat
IPR003591	514	537	SM00369	Leucine-rich repeat
IPR000483	573	623	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 24 RMLWIILLSTIALGWTTPIPLIE 46 PRIMARY 23

2 665 SVLILSLLVLFFSAVFVAAGLFA 687 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	RMLWIILLSTIALGWTTPIPLIE	46	PRIMARY	23
2	665	SVLILSLLVLFFSAVFVAAGLFA	687	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTGCTCCCTTTACACTTGTC

Primer_r
: TTAATGATCTGAGTATGGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTGCTCCCTTTACACTTGTC
Primer_r	: TTAATGATCTGAGTATGGCCC
PCR product length	: 151 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1175 bp
Genome contig ID	gi89161205r_166287204
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TATAGCTTTCCTAATAAAAAGTTTTTGAAAAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACATTATATATAGAGGATACAAAGCTTGAACCTTAAACTCCAGCTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	166387204	166397163	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0848

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information