HUGE |
Gene/Protein Characteristic Table for KIAA0835 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01126 |
---|---|
Accession No. : | AB020642 |
Description : | Myelin transcription factor 1. |
HUGO Gene Name : | |
Clone Name : | hj05861 [Vector Info] |
Flexi ORF Clone : | pF1KA0835
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5533 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1803 bp Genome contig ID gi51511747f_62166271 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
GGGTGATTTCCTAATAAAAGTCCACTCTGACTGTGFlanking genome sequence
(177779 - 177828) ----+----*----+----*----+----*----+----*----+----*
AATCGGTGCTGTGGTCTGTGGGGAGGACATTGTCTCCATTCTTGGTGAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 62266271 62344048 23 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1167 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGGCTGTGCAGATGTGTATGG | |
: TACCCTCTGACCTTGATGATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: AGCACTCCCTCACAGCAACAG | |
: GGCACGGATAACAGCAAATGG | |
: 138 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |