| HUGE |
Gene/Protein Characteristic Table for KIAA0535 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00555 |
|---|---|
| Accession No. : | AB011107 |
| Description : | Suppression of tumorigenicity protein 18. |
| HUGO Gene Name : | suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) (ST18) |
| Clone Name : | hg03847 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0535
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6183 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1047 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : ACCCACCATAGGAAACAAGAC | |
| : TGAAGTGTGGATGAGTCTGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 8 |
| : GeneBridge 4 | |
| : ACCCACCATAGGAAACAAGAC | |
| : TGAAGTGTGGATGAGTCTGTG | |
| : 152 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |