HUGE

Gene/Protein Characteristic Table for KIAA0793

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04986
Accession No. :	AB018336
Description :	FERM, RhoGEF and pleckstrin domain-containing protein 2.
HUGO Gene Name :	FERM, RhoGEF and pleckstrin domain protein 2 (FARP2)
Clone Name :	hk05692 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3997 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 715 bp

Genome contig ID gi89161199f_241844384
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACATTTGATTAAAAATAAACAAACAGCATCTCCCC
Flanking genome sequence
(238546 - 238595)
----+----*----+----*----+----*----+----*----+----*
ACCTGCATTCTCCTCTGCCTGCTCTGTTCTTCCGGTGGGCCAAGCAGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 241944384 242082928 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94887	100.0	FERM, RhoGEF an...	Homo sapiens
XP_001091489	97.0	similar to FERM...	Macaca mulatta
Q91VS8	83.5	FERM, RhoGEF an...	Mus musculus
BAE42626	83.4	unnamed protein...	Mus musculus
XP_001497741	85.5	FERM, RhoGEF an...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023204	1.8e-20	35.7	KIAA0987
AB002336	2.5e-19	34.6	KIAA0338
AB037783	2.9e-12	28.2	KIAA1362
AB046768	3.4e-07	31.3	KIAA1548
AB029035	1e-06	26.7	KIAA1112

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000798 58 77 PR00661 Ezrin/radixin/moesin ERM

IPR000299 78 90 PR00935 Band 4.1

IPR000798 109 128 PR00661 Ezrin/radixin/moesin ERM

IPR000299 143 156 PR00935 Band 4.1

IPR000798 152 173 PR00661 Ezrin/radixin/moesin ERM

IPR000299 156 176 PR00935 Band 4.1

IPR000299 215 231 PR00935 Band 4.1

IPR000798 238 258 PR00661 Ezrin/radixin/moesin ERM

HMMPfam IPR000299 47 235 PF00373 Band 4.1

IPR014847 331 379 PF08736 FERM adjacent (FA)

IPR000219 540 726 PF00621 DH

IPR001849 757 853 PF00169 Pleckstrin-like

IPR001849 931 1027 PF00169 Pleckstrin-like

HMMSmart IPR000299 41 235 SM00295 Band 4.1

IPR000219 540 726 SM00325 DH

IPR001849 757 855 SM00233 Pleckstrin-like

IPR001849 931 1029 SM00233 Pleckstrin-like

ProfileScan IPR000299 45 325 PS50057 Band 4.1

IPR000219 536 727 PS50010 DH

IPR001849 756 853 PS50003 Pleckstrin-like

IPR001849 930 1027 PS50003 Pleckstrin-like

ScanRegExp IPR000299 99 128 PS00660 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	58	77	PR00661	Ezrin/radixin/moesin ERM
IPR000299	78	90	PR00935	Band 4.1
IPR000798	109	128	PR00661	Ezrin/radixin/moesin ERM
IPR000299	143	156	PR00935	Band 4.1
IPR000798	152	173	PR00661	Ezrin/radixin/moesin ERM
IPR000299	156	176	PR00935	Band 4.1
IPR000299	215	231	PR00935	Band 4.1
IPR000798	238	258	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	47	235	PF00373	Band 4.1
IPR014847	331	379	PF08736	FERM adjacent (FA)
IPR000219	540	726	PF00621	DH
IPR001849	757	853	PF00169	Pleckstrin-like
IPR001849	931	1027	PF00169	Pleckstrin-like
HMMSmart	IPR000299	41	235	SM00295	Band 4.1
IPR000219	540	726	SM00325	DH
IPR001849	757	855	SM00233	Pleckstrin-like
IPR001849	931	1029	SM00233	Pleckstrin-like
ProfileScan	IPR000299	45	325	PS50057	Band 4.1
IPR000219	536	727	PS50010	DH
IPR001849	756	853	PS50003	Pleckstrin-like
IPR001849	930	1027	PS50003	Pleckstrin-like
ScanRegExp	IPR000299	99	128	PS00660	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCGATGGCATACACAAAGACT

Primer_r
: AGCCACTTCCCATCTGTTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	715 bp
Genome contig ID	gi89161199f_241844384
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACATTTGATTAAAAATAAACAAACAGCATCTCCCC
Flanking genome sequence (238546 - 238595)	----+--------+--------+--------+--------+----* ACCTGCATTCTCCTCTGCCTGCTCTGTTCTTCCGGTGGGCCAAGCAGAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	241944384	242082928	27	100.0	Perfect prediction

Primer_f	: CCGATGGCATACACAAAGACT
Primer_r	: AGCCACTTCCCATCTGTTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0793

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information