HUGE

Gene/Protein Characteristic Table for KIAA1112

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00742
Accession No. :	AB029035
Description :	Rho guanine nucleotide exchange factor 4.
HUGO Gene Name :	Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4)
Clone Name :	hj05505s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1112
Source :	Human adult brain
Note :	We replaced hj05505, former representative clones for KIAA1112 with hj05505s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1713 bp

Genome contig ID gi89161199f_131291474
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CCACATTTAATTTCATAAATAAATTTATGAAAAGT
Flanking genome sequence
(229822 - 229871)
----+----*----+----*----+----*----+----*----+----*
AACCTGGCTGCTAGCCCGTTTTCTGTGGGTGTGCGTGCATTTTCCTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 131391474 131521294 12 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW51271	100.0	Rho guanine nuc...	Homo sapiens
EAW51270	96.2	Rho guanine nuc...	Homo sapiens
Q9NR80	96.0	Rho guanine nuc...	Homo sapiens
AAF79955	96.6	RhoGEF [Homo sa...	Homo sapiens
XP_001504974	83.7	Rho guanine nuc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007884	1.5e-89	58.2	KIAA0424
AB037836	1.4e-24	36.4	KIAA1415
D63476	8.7e-14	23.8	KIAA0142
AB018336	5.6e-13	26.7	KIAA0793
AB002360	8.2e-12	26.4	KIAA0362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 233 272 PD000066 Src homology-3

FPrintScan IPR001452 235 250 PR00452 Src homology-3

IPR001452 252 261 PR00452 Src homology-3

IPR001452 263 275 PR00452 Src homology-3

HMMPfam IPR001452 221 275 PF00018 Src homology-3

IPR000219 312 491 PF00621 DH

IPR001849 524 630 PF00169 Pleckstrin-like

HMMSmart IPR001452 221 276 SM00326 Src homology-3

IPR000219 312 491 SM00325 DH

IPR001849 524 632 SM00233 Pleckstrin-like

ProfileScan IPR001452 225 277 PS50002 Src homology-3

IPR000219 308 492 PS50010 DH

IPR001849 523 630 PS50003 Pleckstrin-like

ScanRegExp IPR001331 440 465 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	233	272	PD000066	Src homology-3
FPrintScan	IPR001452	235	250	PR00452	Src homology-3
IPR001452	252	261	PR00452	Src homology-3
IPR001452	263	275	PR00452	Src homology-3
HMMPfam	IPR001452	221	275	PF00018	Src homology-3
IPR000219	312	491	PF00621	DH
IPR001849	524	630	PF00169	Pleckstrin-like
HMMSmart	IPR001452	221	276	SM00326	Src homology-3
IPR000219	312	491	SM00325	DH
IPR001849	524	632	SM00233	Pleckstrin-like
ProfileScan	IPR001452	225	277	PS50002	Src homology-3
IPR000219	308	492	PS50010	DH
IPR001849	523	630	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	440	465	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCGTGAGAAGCCATAAGAGAG

Primer_r
: AATGTGGTTTCTGGCTTGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1713 bp
Genome contig ID	gi89161199f_131291474
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCACATTTAATTTCATAAATAAATTTATGAAAAGT
Flanking genome sequence (229822 - 229871)	----+--------+--------+--------+--------+----* AACCTGGCTGCTAGCCCGTTTTCTGTGGGTGTGCGTGCATTTTCCTGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	131391474	131521294	12	99.5	Perfect prediction

Primer_f	: GCGTGAGAAGCCATAAGAGAG
Primer_r	: AATGTGGTTTCTGGCTTGGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1112

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information