HUGE

Gene/Protein Characteristic Table for KIAA0987

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01141
Accession No. :	AB023204
Description :	Band 4.1-like protein 3.
HUGO Gene Name :	erythrocyte membrane protein band 4.1-like 3 (EPB41L3)
Clone Name :	hk01713 [Vector Info]
Flexi ORF Clone :	pF1KA0987
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4446 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1096 bp

Genome contig ID gi51511735r_5282388
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTCTGCATAGCGAAATAAAAATGGCAAATGCACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCTCTAAGTTTGTATGTTTAATAATTTCAGTATTGTATGTGTTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 r 5382388 5533986 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2J2	100.0	Band 4.1-like p...	Homo sapiens
CAH92695	98.8	hypothetical pr...	Pongo abelii
XP_512036	98.9	erythrocyte mem...	Pan troglodytes
XP_870774	89.2	similar to Band...	Bos taurus
XP_001914904	90.6	similar to Band...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002336	5.5e-82	43.2	KIAA0338
AB018336	1.4e-31	35.7	KIAA0793
AB046768	6.8e-15	39.8	KIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000798 151 170 PR00661 Ezrin/radixin/moesin ERM

IPR000299 171 183 PR00935 Band 4.1

IPR000798 201 220 PR00661 Ezrin/radixin/moesin ERM

IPR000299 235 248 PR00935 Band 4.1

IPR000798 244 265 PR00661 Ezrin/radixin/moesin ERM

IPR000299 248 268 PR00935 Band 4.1

IPR000299 309 325 PR00935 Band 4.1

IPR000798 332 352 PR00661 Ezrin/radixin/moesin ERM

HMMPfam IPR000299 140 329 PF00373 Band 4.1

IPR014847 423 471 PF08736 FERM adjacent (FA)

IPR007477 726 793 PF04382 SAB

IPR008379 995 1108 PF05902 Band 4.1

HMMSmart IPR000299 134 329 SM00295 Band 4.1

ProfileScan IPR000299 138 419 PS50057 Band 4.1

ScanRegExp IPR000299 192 220 PS00660 Band 4.1

IPR000299 299 328 PS00661 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	151	170	PR00661	Ezrin/radixin/moesin ERM
IPR000299	171	183	PR00935	Band 4.1
IPR000798	201	220	PR00661	Ezrin/radixin/moesin ERM
IPR000299	235	248	PR00935	Band 4.1
IPR000798	244	265	PR00661	Ezrin/radixin/moesin ERM
IPR000299	248	268	PR00935	Band 4.1
IPR000299	309	325	PR00935	Band 4.1
IPR000798	332	352	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	140	329	PF00373	Band 4.1
IPR014847	423	471	PF08736	FERM adjacent (FA)
IPR007477	726	793	PF04382	SAB
IPR008379	995	1108	PF05902	Band 4.1
HMMSmart	IPR000299	134	329	SM00295	Band 4.1
ProfileScan	IPR000299	138	419	PS50057	Band 4.1
ScanRegExp	IPR000299	192	220	PS00660	Band 4.1
IPR000299	299	328	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 664 FLFIFFFLLSASFSVPYALTLSF 686 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	664	FLFIFFFLLSASFSVPYALTLSF	686	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCCAAGCCTTAAACTGTAC

Primer_r
: ATGCAGGTGATCGTGTAATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1096 bp
Genome contig ID	gi51511735r_5282388
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTCTGCATAGCGAAATAAAAATGGCAAATGCACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCTCTAAGTTTGTATGTTTAATAATTTCAGTATTGTATGTGTTTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	r	5382388	5533986	23	100.0	Perfect prediction

Primer_f	: GAGCCAAGCCTTAAACTGTAC
Primer_r	: ATGCAGGTGATCGTGTAATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0987

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information