HUGE

Gene/Protein Characteristic Table for KIAA0780

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00635
Accession No. :	AB018323
Description :	JmjC domain-containing histone demethylation protein 3C.
HUGO Gene Name :	jumonji domain containing 2C (JMJD2C)
Clone Name :	hk05362 [Vector Info]
Flexi ORF Clone :	pF1KSDA0780
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 878 bp

Genome contig ID gi89161216f_6648061
PolyA signal sequence
(CATAAA,-34)
+----*----+----*----+----*----+----
ACATAAACTACACTAACAATAGCTGATGAGCTACC
Flanking genome sequence
(512858 - 512907)
----+----*----+----*----+----*----+----*----+----*
TAAAAAAAAAAAAAAAAAAAGCAAAAAAAAACTCATAATGTTTTAAGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 6748061 7160917 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09844	100.0	jmjC domain-con...	synthetic construct
CAH73283	99.9	jumonji domain ...	Homo sapiens
EAW58730	99.5	jumonji domain ...	Homo sapiens
XP_001144111	99.2	jumonji domain ...	Pan troglodytes
AAI04860	99.7	Jumonji domain ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020683	4.9e-90	54.7	KIAA0876
AB014577	5e-85	55.2	KIAA0677
D87072	1.9e-14	33.2	KIAA0234
D86969	3.5e-12	40.4	KIAA0215
AB033112	8.1e-12	40.5	KIAA1286

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003349 70 115 PF02375 Transcription factor jumonji

IPR013129 230 346 PF02373 Transcription factor jumonji

HMMSmart IPR003349 68 110 SM00545 Transcription factor jumonji

IPR003347 197 363 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

IPR001965 742 800 SM00249 Zinc finger

IPR001965 862 918 SM00249 Zinc finger

IPR002999 930 987 SM00333 Tudor

IPR002999 988 1044 SM00333 Tudor

ProfileScan IPR003349 69 111 PS51183 Transcription factor jumonji

IPR003347 197 363 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	70	115	PF02375	Transcription factor jumonji
IPR013129	230	346	PF02373	Transcription factor jumonji
HMMSmart	IPR003349	68	110	SM00545	Transcription factor jumonji
IPR003347	197	363	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965	742	800	SM00249	Zinc finger
IPR001965	862	918	SM00249	Zinc finger
IPR002999	930	987	SM00333	Tudor
IPR002999	988	1044	SM00333	Tudor
ProfileScan	IPR003349	69	111	PS51183	Transcription factor jumonji
IPR003347	197	363	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGATGAAGAGTTACCCAAGAG

Primer_r
: AAACATGAGGTGAGGACAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGATGAAGAGTTACCCAAGAG
Primer_r	: AAGCCCAAGTATGTTTCCTGC
PCR product length	: 132 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	878 bp
Genome contig ID	gi89161216f_6648061
PolyA signal sequence (CATAAA,-34)	+--------+--------+----*----+---- ACATAAACTACACTAACAATAGCTGATGAGCTACC
Flanking genome sequence (512858 - 512907)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAAAAAAAAAGCAAAAAAAAACTCATAATGTTTTAAGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	6748061	7160917	21	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0780

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information