HUGE |
Gene/Protein Characteristic Table for KIAA0667 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04431 |
---|---|
Accession No. : | AB014567 |
Description : | Cullin-associated NEDD8-dissociated protein 2. |
HUGO Gene Name : | cullin-associated and neddylation-dissociated 2 (putative) (CAND2) |
Clone Name : | hk02319 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4157 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 1111 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000357 | 73 | 105 | PF02985 | HEAT |
IPR000357 | 152 | 188 | PF02985 | HEAT | |
IPR000357 | 415 | 451 | PF02985 | HEAT | |
IPR000357 | 755 | 791 | PF02985 | HEAT | |
IPR013932 | 919 | 1085 | PF08623 | TATA-binding protein interacting (TIP20) |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CATAGTCTGTCTGGTTCCTTC | |
: GAGCACTAACTTCAGGCATTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: CATAGTCTGTCTGGTTCCTTC | |
: GAGCACTAACTTCAGGCATTG | |
: 152 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |