ROUGE |
Gene/Protein Characteristic Table for mKIAA0667 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129186 |
---|---|
TBP-interacting protein b. | |
mpm08346 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4267 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 534 bp Genome contig ID gi65504368f_116112122 PolyA signal sequence
(TATAAA,-24) +----*----+----*----+----*----+----
GAAAATTTAAGTATAAATGACAGGTTTTGATTTTTFlanking genome sequence
(129814 - 129863) ----+----*----+----*----+----*----+----*----+----*
AAGACATTGTTTCTCTTTGTAGCCACATATGGCCCAGACTCAAATCCACC
KIAA Alignment based on: KIAA0667 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..3733
Length: 1243 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |