HUGE |
Gene/Protein Characteristic Table for KIAA0829 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01125 |
---|---|
Accession No. : | AB020636 |
Description : | Cullin-associated NEDD8-dissociated protein 1. |
HUGO Gene Name : | cullin-associated and neddylation-dissociated 1 (CAND1) |
Clone Name : | hh04834s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0829
![]() |
Source : | Human adult brain |
Note : | We replaced hh04834, former representative clones for KIAA0829 with hh04834s1. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5813 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1781 bp Genome contig ID gi89161190f_65849426 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ATGGTTTTACAATAAATTACAATACTGCAGGCTCTFlanking genome sequence
(145234 - 145283) ----+----*----+----*----+----*----+----*----+----*
AGGACTGAACAGGAGACTGACATGCATATGTTGTGTGAATGTCTTAGTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 65949426 65994658 15 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1277 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTCAGTTACCCATTTGTGTG | |
: AAACCTGTGATAGCTGGCTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |