HUGE

Gene/Protein Characteristic Table for KIAA0829

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01125
Accession No. :	AB020636
Description :	Cullin-associated NEDD8-dissociated protein 1.
HUGO Gene Name :	cullin-associated and neddylation-dissociated 1 (CAND1)
Clone Name :	hh04834s1 [Vector Info]
Flexi ORF Clone :	pF1KA0829
Source :	Human adult brain
Note :	We replaced hh04834, former representative clones for KIAA0829 with hh04834s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 5813 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1781 bp

Genome contig ID gi89161190f_65849426
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATGGTTTTACAATAAATTACAATACTGCAGGCTCT
Flanking genome sequence
(145234 - 145283)
----+----*----+----*----+----*----+----*----+----*
AGGACTGAACAGGAGACTGACATGCATATGTTGTGTGAATGTCTTAGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 65949426 65994658 15 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1277 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509204	99.5	TIP120 protein ...	Pan troglodytes
XP_001106780	99.6	similar to TIP1...	Macaca mulatta
Q86VP6	100.0	Cullin-associat...	Homo sapiens
AAH50341	99.9	Cullin-associat...	Homo sapiens
BAF85145	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014567	4.3e-164	55.2	KIAA0667

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 90 126 PF02985 HEAT

IPR000357 217 253 PF02985 HEAT

IPR000357 297 333 PF02985 HEAT

IPR000357 899 934 PF02985 HEAT

IPR000357 1048 1084 PF02985 HEAT

IPR013932 1086 1252 PF08623 TATA-binding protein interacting (TIP20)

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	90	126	PF02985	HEAT
IPR000357	217	253	PF02985	HEAT
IPR000357	297	333	PF02985	HEAT
IPR000357	899	934	PF02985	HEAT
IPR000357	1048	1084	PF02985	HEAT
IPR013932	1086	1252	PF08623	TATA-binding protein interacting (TIP20)

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTCAGTTACCCATTTGTGTG

Primer_r
: AAACCTGTGATAGCTGGCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1781 bp
Genome contig ID	gi89161190f_65849426
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATGGTTTTACAATAAATTACAATACTGCAGGCTCT
Flanking genome sequence (145234 - 145283)	----+--------+--------+--------+--------+----* AGGACTGAACAGGAGACTGACATGCATATGTTGTGTGAATGTCTTAGTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	65949426	65994658	15	99.7	Perfect prediction

Primer_f	: TCTCAGTTACCCATTTGTGTG
Primer_r	: AAACCTGTGATAGCTGGCTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0829

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information