HUGE

Gene/Protein Characteristic Table for KIAA0635

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04533
Accession No. :	AB014535
Description :	Centrosomal protein of 135 kDa.
HUGO Gene Name :
Clone Name :	hj03253 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5138 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1765 bp

Genome contig ID gi89161207f_56425789
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
ATGGAAATCTTTTAATAAATATATGTAAATAAAAT
Flanking genome sequence
(168240 - 168289)
----+----*----+----*----+----*----+----*----+----*
AAAAAATATTTGTCTCCACCTTTTCCCCAAAAGCAACAGCAAGACATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 56525789 56594027 19 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q66GS9	100.0	Centrosomal pro...	Homo sapiens
AAI36536	99.9	Centrosomal pro...	Homo sapiens
XP_517281	99.2	centrosome prot...	Pan troglodytes
EAX05478	99.9	hCG2027094 [Hom...	Homo sapiens
XP_001491802	90.5	centrosomal pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	2.2e-07	23.8	KIAA0004
AB002376	6.3e-05	21.5	KIAA0378
AB007923	7.2e-05	22.8	KIAA0454
AB011140	0.00018	21.9	KIAA0568
AB051536	0.00025	21.2	KIAA1749

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 221 434 PD023692 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	221	434	PD023692	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACACCACCCCTTAGTTCCAC

Primer_r
: GAGGTAGAATTTGTGTCCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAATAAAGACCTGGAGAAGC
Primer_r	: TTCCAACTGCTGTGCTAACTG
PCR product length	: 143 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1765 bp
Genome contig ID	gi89161207f_56425789
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- ATGGAAATCTTTTAATAAATATATGTAAATAAAAT
Flanking genome sequence (168240 - 168289)	----+--------+--------+--------+--------+----* AAAAAATATTTGTCTCCACCTTTTCCCCAAAAGCAACAGCAAGACATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	56525789	56594027	19	99.5	Perfect prediction

Primer_f	: TACACCACCCCTTAGTTCCAC
Primer_r	: GAGGTAGAATTTGTGTCCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0635

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information