HUGE

Gene/Protein Characteristic Table for KIAA1749

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04545
Accession No. :	AB051536
Description :	cingulin-like 1.
HUGO Gene Name :	cingulin-like 1 (CGNL1)
Clone Name :	pj02119y1 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced pj02119, former representative clones for KIAA1749 with pj02119y1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 6373 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3227 bp

Genome contig ID gi51511731f_55418253
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGATTTCCTTTCAATAAACGCTGTCACCCAATGGG
Flanking genome sequence
(211954 - 212003)
----+----*----+----*----+----*----+----*----+----*
AATTTTGACTCTCCTGTGATTGTGACTTCTTTGTTTTCTCCAGAGCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 55518253 55630205 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1047 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q0VF96	99.9	Cingulin-like p...	Homo sapiens
AAH93827	99.8	Cingulin-like 1...	Homo sapiens
XP_510437	99.2	cingulin-like 1...	Pan troglodytes
AAT37906	99.0	paracingulin [H...	Homo sapiens
XP_001092704	97.6	similar to cing...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037740	2.2e-32	33.2	KIAA1319
AB020673	3.8e-14	26.0	KIAA0866
AB111886	1.2e-10	24.6	KIAA2034
AB023217	3.6e-09	24.7	KIAA1000
AB040945	4.1e-08	24.0	KIAA1512

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002928 809 1003 PF01576 Myosin tail

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002928	809	1003	PF01576	Myosin tail

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3227 bp
Genome contig ID	gi51511731f_55418253
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGATTTCCTTTCAATAAACGCTGTCACCCAATGGG
Flanking genome sequence (211954 - 212003)	----+--------+--------+--------+--------+----* AATTTTGACTCTCCTGTGATTGTGACTTCTTTGTTTTCTCCAGAGCTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	55518253	55630205	18	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1749

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information