HUGE

Gene/Protein Characteristic Table for KIAA0378

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00520
Accession No. :	AB002376
Description :	ERC protein 2.
HUGO Gene Name :	ELKS/RAB6-interacting/CAST family member 2 (ERC2)
Clone Name :	hh00502s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0378
Source :	Human adult brain
Note :	We replaced hh00502, former representative clones for KIAA0378 with hh00502s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6137 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3007 bp

Genome contig ID gi89161205r_55417376
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TATTCATCAAATAAACCTTGTTTCTTTCTGAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTCATTCTATCTCTAATAAATGCTCCAATTGTGCAGTTTCTAACATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 55517376 56477431 17 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 970 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15083	100.0	ERC protein 2.	Homo sapiens
XP_516542	99.9	cytomatrix prot...	Pan troglodytes
XP_001101499	99.7	similar to cyto...	Macaca mulatta
XP_001490805	99.5	ELKS/RAB6-inter...	Equus caballus
XP_849232	99.5	similar to cyto...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029004	1.1e-90	69.1	KIAA1081
AB033101	7.9e-05	24.9	KIAA1275
AB014535	0.00016	20.9	KIAA0635
D13629	0.00017	21.5	KIAA0004
AB002371	0.00019	22.8	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AATAAGGCGATCAGCACAAAG

Primer_r
: CATGTGGGTTGTGATATTGAC

PCR conditions
: 95 °C15 sec62 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATAAGGCGATCAGCACAAAG
Primer_r	: CATGTGGGTTGTGATATTGAC
PCR product length	: 206 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3007 bp
Genome contig ID	gi89161205r_55417376
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TATTCATCAAATAAACCTTGTTTCTTTCTGAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTCATTCTATCTCTAATAAATGCTCCAATTGTGCAGTTTCTAACATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	55517376	56477431	17	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0378

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information