HUGE

Gene/Protein Characteristic Table for KIAA0619

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01105
Accession No. :	AB014519
Description :	Rho-associated protein kinase 2.
HUGO Gene Name :
Clone Name :	hg04117 [Vector Info]
Flexi ORF Clone :	pF1KA0619
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6409 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1788 bp

Genome contig ID gi89161199r_11139510
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCAGCTGAACAAGACTCCGTCTC
Flanking genome sequence
(99719 - 99670)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTCATCTAATATTTCGATGAAGGAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 11239229 11402162 32 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525689	99.8	Rho-associated,...	Pan troglodytes
XP_001096931	99.0	Rho-associated,...	Macaca mulatta
O75116	100.0	Rho-associated ...	Homo sapiens
BAA75636	99.9	Rho kinase [Hom...	Homo sapiens
NP_004841	99.9	Rho-associated,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	1.1e-34	30.0	KIAA1124
AB023182	6.9e-11	40.5	KIAA0965
D86959	7.5e-09	23.4	KIAA0204
AB023190	1.2e-07	38.3	KIAA0973
AB018350	1.2e-07	38.0	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 132 394 PD000001 Protein kinase

HMMPfam IPR000719 132 394 PF00069 Protein kinase

IPR000961 414 459 PF00433 Protein kinase

IPR000861 515 599 PF02185 HR1-like rho-binding repeat

IPR015008 1018 1086 PF08912 Rho Binding

IPR001849 1191 1275 PF00169 Pleckstrin-like

IPR002219 1301 1353 PF00130 Protein kinase C

HMMSmart IPR001245 132 388 SM00219 Tyrosine protein kinase

IPR002290 132 394 SM00220 Serine/threonine protein kinase

IPR000961 397 457 SM00133 Protein kinase

IPR001849 1191 1391 SM00233 Pleckstrin-like

IPR002219 1301 1355 SM00109 Protein kinase C

ProfileScan IPR000719 132 394 PS50011 Protein kinase

IPR001849 1190 1389 PS50003 Pleckstrin-like

IPR002219 1300 1355 PS50081 Protein kinase C

ScanRegExp IPR000719 138 161 PS00107 Protein kinase

IPR008271 250 262 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	132	394	PD000001	Protein kinase
HMMPfam	IPR000719	132	394	PF00069	Protein kinase
IPR000961	414	459	PF00433	Protein kinase
IPR000861	515	599	PF02185	HR1-like rho-binding repeat
IPR015008	1018	1086	PF08912	Rho Binding
IPR001849	1191	1275	PF00169	Pleckstrin-like
IPR002219	1301	1353	PF00130	Protein kinase C
HMMSmart	IPR001245	132	388	SM00219	Tyrosine protein kinase
IPR002290	132	394	SM00220	Serine/threonine protein kinase
IPR000961	397	457	SM00133	Protein kinase
IPR001849	1191	1391	SM00233	Pleckstrin-like
IPR002219	1301	1355	SM00109	Protein kinase C
ProfileScan	IPR000719	132	394	PS50011	Protein kinase
IPR001849	1190	1389	PS50003	Pleckstrin-like
IPR002219	1300	1355	PS50081	Protein kinase C
ScanRegExp	IPR000719	138	161	PS00107	Protein kinase
IPR008271	250	262	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTTACAGTTTACGCAGGAC

Primer_r
: CTTTACGCTTACCATTGCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGTTACAGTTTACGCAGGAC
Primer_r	: CTTTACGCTTACCATTGCTGC
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1788 bp
Genome contig ID	gi89161199r_11139510
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAGCTGAACAAGACTCCGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTCATCTAATATTTCGATGAAGGAAATAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	11239229	11402162	32	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0619

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information