HUGE

Gene/Protein Characteristic Table for KIAA0573

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00564
Accession No. :	AB011145
Description :	Thioredoxin domain-containing protein 4 precursor.
HUGO Gene Name :	thioredoxin domain containing 4 (endoplasmic reticulum) (TXNDC4)
Clone Name :	hj00186 [Vector Info]
Flexi ORF Clone :	pF1KSDA0573
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4796 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3439 bp

Genome contig ID gi89161216r_101681282
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
AAAATAAAATGACATGAAATTGCAAAAATGAAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTAAAAAAAAAAAAATTGTTGTCACCTTAAATGATTTCAAGGTTGTTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 101781282 101901079 12 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 451 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BS26	3.3e-165	100.0	Thioredoxin dom...	Homo sapiens
AAQ89407	1.4e-164	99.8	TXNDC4 [Homo sa...	Homo sapiens
BAE91584	7.1e-164	99.3	unnamed protein...	Macaca fascicularis
BAE88644	1.1e-163	99.0	unnamed protein...	Macaca fascicularis
EDL02341	1e-159	87.5	thioredoxin dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058733	0.00012	21.2	KIAA1830

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006662 94 102 PR00421 Thioredoxin-related

IPR006662 102 111 PR00421 Thioredoxin-related

IPR006662 148 159 PR00421 Thioredoxin-related

HMMPfam IPR013766 75 184 PF00085 Thioredoxin domain

ScanRegExp IPR000886 448 451 PS00014 Endoplasmic reticulum targeting sequence

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	94	102	PR00421	Thioredoxin-related
IPR006662	102	111	PR00421	Thioredoxin-related
IPR006662	148	159	PR00421	Thioredoxin-related
HMMPfam	IPR013766	75	184	PF00085	Thioredoxin domain
ScanRegExp	IPR000886	448	451	PS00014	Endoplasmic reticulum targeting sequence

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGGGCATCTAAGGCATCTCAG

Primer_r
: TTTCACTCTCCTCTCTGTAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGGCATCTAAGGCATCTCAG
Primer_r	: TTTCACTCTCCTCTCTGTAGC
PCR product length	: 108 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3439 bp
Genome contig ID	gi89161216r_101681282
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAATGACATGAAATTGCAAAAATGAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTAAAAAAAAAAAAATTGTTGTCACCTTAAATGATTTCAAGGTTGTTAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	101781282	101901079	12	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0573

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information