HUGE

Gene/Protein Characteristic Table for KIAA1830

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00928
Accession No. :	AB058733
Description :	Protein disulfide-isomerase TXNDC10 precursor.
HUGO Gene Name :	thioredoxin domain containing 10 (TXNDC10)
Clone Name :	hj01608 [Vector Info]
Flexi ORF Clone :	pF1KSDA1830
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4702 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3240 bp

Genome contig ID gi51511735r_64391908
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTTTGTTTTTCTAAAATAAAGTAATTGAAAACCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAATTGTTTCTTATTTTTACTGTGTATCCTGGTTGTTTGCAATATGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 r 64491908 64533295 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JJ7	1.4e-193	100.0	Protein disulfi...	Homo sapiens
XP_001150102	3.5e-193	99.6	thioredoxin dom...	Pan troglodytes
Q5R875	1.6e-192	99.1	Protein disulfi...	Pongo abelii
XP_001493036	2.4e-180	92.7	thioredoxin dom...	Equus caballus
XP_001063895	1.2e-179	87.2	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011145	2e-06	20.7	KIAA0573
AB023179	5e-05	22.2	KIAA0962

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006662 76 84 PR00421 Thioredoxin-related

IPR006662 84 93 PR00421 Thioredoxin-related

IPR006662 127 138 PR00421 Thioredoxin-related

HMMPfam IPR013766 58 161 PF00085 Thioredoxin domain

ScanRegExp IPR006662 77 95 PS00194 Thioredoxin-related

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	76	84	PR00421	Thioredoxin-related
IPR006662	84	93	PR00421	Thioredoxin-related
IPR006662	127	138	PR00421	Thioredoxin-related
HMMPfam	IPR013766	58	161	PF00085	Thioredoxin domain
ScanRegExp	IPR006662	77	95	PS00194	Thioredoxin-related

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 40 TALRLCATVVVLDMVVCKGFVED 62 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	40	TALRLCATVVVLDMVVCKGFVED	62	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCAGGTGAATTAGCAGTAC

Primer_r
: AATGTCAAGCCTAATCCCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3240 bp
Genome contig ID	gi51511735r_64391908
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTTGTTTTTCTAAAATAAAGTAATTGAAAACCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAATTGTTTCTTATTTTTACTGTGTATCCTGGTTGTTTGCAATATGAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	r	64491908	64533295	16	99.3	Perfect prediction

Primer_f	: GAGCAGGTGAATTAGCAGTAC
Primer_r	: AATGTCAAGCCTAATCCCACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1830

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information