HUGE |
Gene/Protein Characteristic Table for KIAA0555 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01092 |
---|---|
Accession No. : | AB011127 |
Description : | Janus kinase and microtubule-interacting protein 2. |
HUGO Gene Name : | janus kinase and microtubule interacting protein 2 (JAKMIP2) |
Clone Name : | hh00882 [Vector Info] |
Flexi ORF Clone : | pF1KA0555
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5913 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3278 bp Genome contig ID gi51511721r_146848183 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAATGCTTCCCTTGGATGGGATGTTCAGCAATAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGTTATCAATAACTGAGATTTCCTGTGGCCCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 146948183 147142298 21 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 802 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CAAGCTGCCAATGAAGACCTC | |
: TGACATTTCCTGCTCGTGCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: ATTCCGTCTGCTCCAACACAC | |
: CCCTAAACACATCTAAAGCTG | |
: 75 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |