HUGE

Gene/Protein Characteristic Table for KIAA0949

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00156
Accession No. :	AB023166
Description :	Citron Rho-interacting kinase.
HUGO Gene Name :	citron (rho-interacting, serine/threonine kinase 21) (CIT)
Clone Name :	af07325 [Vector Info]
Flexi ORF Clone :	pF1KA0949
Source :	Human brain (amygdala)
Note :	We replaced hj05069, former representative clones for KIAA0949 with af07325. (1999/6/16)

Features of the cloned DNA sequence	Description

Length: 8516 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2438 bp

Genome contig ID gi89161190r_118507981
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAACAATTAGTGAAATAAAGCAATGATCTAAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTGTGCTTTAGTGCAATGACCTCTTCTTTTTTTGAGAGACTGTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 118607981 118726665 39 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10406	100.0	citron Rho-inte...	synthetic construct
XP_001158885	99.9	citron isoform ...	Pan troglodytes
EAW98156	99.9	citron (rho-int...	Homo sapiens
AAC27933	98.3	Citron-K kinase...	Mus musculus
EDL19840	98.3	citron, isoform...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029004	1.8e-06	23.4	KIAA1081
AB037740	1.2e-05	24.0	KIAA1319
AB040945	8.4e-05	24.7	KIAA1512
AB111886	0.00011	22.7	KIAA2034
AB002371	0.00022	23.8	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002219 896 947 PF00130 Protein kinase C

IPR001849 977 1096 PF00169 Pleckstrin-like

IPR001180 1126 1416 PF00780 Citron-like

HMMSmart IPR002219 896 944 SM00109 Protein kinase C

IPR001849 977 1098 SM00233 Pleckstrin-like

IPR001180 1125 1422 SM00036 Citron-like

ProfileScan IPR002219 895 944 PS50081 Protein kinase C

IPR001849 976 1096 PS50003 Pleckstrin-like

ScanRegExp IPR005479 678 685 PS00867 Carbamoyl-phosphate synthase L chain

IPR002219 896 944 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	896	947	PF00130	Protein kinase C
IPR001849	977	1096	PF00169	Pleckstrin-like
IPR001180	1126	1416	PF00780	Citron-like
HMMSmart	IPR002219	896	944	SM00109	Protein kinase C
IPR001849	977	1098	SM00233	Pleckstrin-like
IPR001180	1125	1422	SM00036	Citron-like
ProfileScan	IPR002219	895	944	PS50081	Protein kinase C
IPR001849	976	1096	PS50003	Pleckstrin-like
ScanRegExp	IPR005479	678	685	PS00867	Carbamoyl-phosphate synthase L chain
IPR002219	896	944	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2438 bp
Genome contig ID	gi89161190r_118507981
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAACAATTAGTGAAATAAAGCAATGATCTAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGTGCTTTAGTGCAATGACCTCTTCTTTTTTTGAGAGACTGTGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	118607981	118726665	39	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0949

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information