HUGE

Gene/Protein Characteristic Table for KIAA0516

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06955
Accession No. :	AB011088
Description :	C-jun-amino-terminal kinase-interacting protein 4.
HUGO Gene Name :	sperm associated antigen 9 (SPAG9)
Clone Name :	hg00484s2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00484 and hg00484s1, former representative clones for KIAA0516 with hg00484s2. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4437 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 284 bp

Genome contig ID gi51511734r_46298348
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAACTGGTGAATTATAGAAAGCAATCCAGATGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTTTACTCTGCCACAGTCTAATGTCATTCACTTCATTTGATGGGGTCACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 46398348 46553203 30 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1382 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60271	100.0	C-jun-amino-ter...	Homo sapiens
XP_001171175	99.8	sperm associate...	Pan troglodytes
XP_852670	97.6	similar to sper...	Canis lupus fam...
Q58A65	96.5	C-jun-amino-ter...	Mus musculus
BAD93176	96.4	JSAP2a [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028989	1.9e-70	57.1	KIAA1066
AB002335	4.9e-07	23.8	KIAA0337
AB046846	1e-05	25.9	KIAA1626
AB002292	6.3e-05	26.1	KIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTCGGGACATTTAGATACATC

Primer_r
: TGGGGTCACTTGTTAGCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCGGGACATTTAGATACATC
Primer_r	: TGGGGTCACTTGTTAGCTGTC
PCR product length	: 162 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	284 bp
Genome contig ID	gi51511734r_46298348
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAACTGGTGAATTATAGAAAGCAATCCAGATGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTTACTCTGCCACAGTCTAATGTCATTCACTTCATTTGATGGGGTCACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	46398348	46553203	30	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0516

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information